Command line to download blast database / protein
...oad all available nr - protein database as a single file #Database location - NCBI where all databases...to download wget 'ftp://ftp.ncbi.nlm.nih.gov/blast/db/nr.*.tar.gz' #cat them into one cat nr.*.tar.g...957 days ago
Extract the values using ids !
#Awk script awk 'NR==FNR{tgts[$1]; next} $1 in tgts' file1 file2 Look: $ cat file1 11002 10995 48981 79600 $ cat file2 10993 item 0 11002 item 6 10995 item 7 79600 ite...908 days ago
Extract all fasta sequences except ids !
...seqtk subseq omi_ids.fa omi_single_id.txt > omi_single_id.fa #cat omi and all the rest cat omi_single_id.fa filtered_wit...r.pl omi_kmer19_formated.fa > omi_kmer19_formated_numbered.fa # cat all *.rd file cat *.rd > all...841 days ago
bash script to extract sequence by ids !
...quences: # Create test input: cat > in.fasta BGI_novel_T016313...olyc03g025570.2.1 TTCAAGTGTTAGTTTCACATCAT >BGI_novel_T018109 Solyc0..._T016817 BGI_novel_G001220 GCCCAAGTCATAGGTAGTGCCTG >BGI_novel_T0161....txt > out.fasta cat out.fasta Output: >BGI_no...837 days ago