Blast script to index and extract sequence !!
...GCAGCTTCTGAACTG GTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGAC .... # query the blast database by id and coordinates $ blastdbcmd -db EC -range 1...2853 days ago
Transpose the file coordinates and plot dendrogram in R
#Save this as tr.awk { for (i=1; i2618 days ago
Extract fasta sequence from a multifasta file with coordinates
#!/usr/bin/perl use Bio::DB::Fasta; #USAGE perl extractFASTAwithSIZE.pl finalSample_filtered.fa 0 1000 > aaaaaa.fa my $fastaFile = shift; my $querySizeST = shi...2533 days ago
2127 days ago
Bash script to extract intronic fragments !
#To obtain introns, we simply need the gene and exonic coordinates; #by subtracting the exonic regions from the genic region, we have the intronic region. gunzip -c genome_file.gtf...1366 days ago