Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $min...@microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($geno...108 days ago
Perl script to calculate the basic stats of the assembled genome !
...# Input file containing the genome assembly in FASTA format my $input_file = 'genome_assembly.fasta'; # Create...stics and information print "Genome Assembly Statistics:\n"; pri...engths_ref) { $total_size += $length; } my $h...108 days ago
Python script for basic stats of the assembled genome !
...cs # Input file containing the genome assembly in FASTA format input_file = 'genome_assembly.fasta' # Variable...alculate_n50(lengths): total_size = sum(lengths) half_size = total_size / 2 cumulat...tatistics and information print("Genome Assembly Statistics:") pri...108 days ago