Omicron Sequences accession number !
EPI_ISL_6647956 EPI_ISL_6647957 EPI_ISL_6647958 EPI_ISL_6647959 EPI_ISL_6647960 EPI_ISL_6647962 EPI_ISL_6647961 Search the IDs in https://www.epicov.org/epi3/frontend899 days ago
Extract fasta header with ids !
#Extract all the fasta header name with certain ids kraken --db ../../../../DATABASE/minikraken_20171019_...a more out.fa_class.txt | grep "227859" | awk '{print $2}' > all_real_ids.txt minimap2 -t 36 -k19 -w...891 days ago
Extract the sequences with IDs !
#sed -i 's/\_/ /g' Delta_seqID_from_lineage_report.txt seqtk subseq genomic.fna Delta_seqID_from_lineage_report.txt > Delta.fasta #Split the fasta in 11 equal sequences subsets pyfasta split -n 11 Delta.fasta865 days ago
Installing SEVA environment in Conda !
...######################################################################################################################################## | 100% r-ids-1.0.1 | 126 KB |...852 days ago
Extract all fasta sequences except ids !
awk 'BEGIN{while((getline0)l[">"$1]=1}/^>/{f=!l[$1]}f' genomic.fna > filtered_without_omi.fasta #extract subseq seqtk subseq omi_ids.fa omi_single_id.txt > omi_single_id.fa #...843 days ago
bash script to extract sequence by ids !
...BGI_novel_T016817 BGI_novel_G001220 GCCCAAGTCATAGGTAGTGCCTG >BGI_novel_T016141 Solyc03g007600.3.1 ACGTACGTACGTACGTACGTACG EOF cat > gene_ids.txt ids_gene_ids.tsv # Select ids...838 days ago