Raku script to find SSRs in fastq file !
sub find-ssrs(Str $sequence) { my @ssrs; for 2..$sequence.chars -> $min-rep...ity lines) $fh.readline; $fh.readline; my @ssrs = find-ssrs($sequence); i...126 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($s...} # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-sequence);...108 days ago
Python script to find repeats in the DNA sequence !
def find_repeats(sequence, min_repeat_length=3): repeats = [] for i in...urn repeats # Example usage genome_sequence = "ATCGATCGATCGATCG" result = find_repeats(genome_sequence) p...108 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $mi...# Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-seque...108 days ago
Raku script to find overlaps between two bed files !
#!/usr/bin/env raku # Check if the correct number of arguments are provided if @*ARGS.elems != 2 { say "Usage: ./compare_bed_files.raku file1.bed file2.bed";...108 days ago
Perl script to find overlaps between two bed files !
#!/usr/bin/perl use strict; use warnings; # Check if the correct number of arguments are provided if (@ARGV != 2) { die "Usage: $0 file1.bed file2.bed\n"; } # Read the contents of the two BED files my $file1 = shift @ARGV; my $file2 = shift @ARGV; open my $fh1, '108 days ago