Results for "pairs"
Top-level pages
...ons.fq qtrim=rl trimq=10 minlength=50 Subsample 10% of the first 20000 pairs in an interleaved file: refor...t" overrides interleaving autodetection, to ensure reads are treated as pairs) Pipe in a gzipped sam file...2716 days ago
List of Bioinformatics Software Tools for Next Generation Sequencing
...sets; fasta, fastq, gzipped or not; no reference genome required; read pairs can be given Output: FASTA...ription: command-line application to identify SNPs between tumor/normal pairs- predicts probability of diff...2911 days ago
- ...CIGAR string of 5M2I63M indicates that the first 5 base pairs of the read align to the reference, followed by 2 base pairs, which are unique to the read...nced form a pair, and are frequently referred to as mate-pairs. QNAME: unique identifier of...
2872 days ago
Genome Assembly Tools and Software - PART1 !!
...ash; Iterative Virus Assembler IVA is a de novo assembler designed to assemble virus genomes that have no repeat sequences, using Illumina read pairs sequenced from mixed populati...2688 days ago
Quick next generation sequencing (NGS) terms definition
...fragment size.discordant reads: briefly, any non-concordant read pair is considered discordant. Note that, by definition, the discordant read pairs signal potential SVs. The seq...2525 days ago
- ...: zcat *.gz | echo $((`wc -l`/4)) To count reads in a all .fastq files in your current folder: cat *.fastq | echo $((`wc -l`/4)) To count base pairs in a all .fastq.gz files in y...
2220 days ago
Protein-Protein Interaction Sites Predictions !
...Sites PPISP A consensus neural network method for predicting protein-protein interaction sites HOMCOS A server to predict interacting protein pairs and interacting sites by homo...2205 days ago
- ...un1/contigs.reduced.fa 24 97520 39.355 17 94157 7321 2195 0 29603 19505 pairs. 17302 passed filtering [88.71%]. 1627 in different contigs [8.34%]. 1526 pairs. 558 in different contigs [36...
2193 days ago
LINKS scaffolder bloomfilter setting !
...uired) -s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fast...AGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC -d distance between k-mer pairs (ie. target distances to re-s...2154 days ago
