Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3282 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G",  ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3265 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3265 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3265 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2347 days ago
Awesome perl frameworks, libraries and software - PART 2
licheng/gccfilter - gccfilter is a perl filter to colorize and simplify (or expand) gcc diagnostic messages. gccfilter is particularly aimed at g++ (i.e. dealinging with C++) messages which can contain lot of template-related errors or warnings difficult to sort out. klenin/cats-main ...Tags: Awesome, perl, frameworks, libraries, software
2507 days ago
Awesome perl frameworks, libraries and software - PART 4
tjstein/php5-fpm-munin-plugins - A set of Munin plugins for PHP5-FPM perusio/nginx-munin - A set of plugins for monitoring nginx with Munin openresty/lua-resty-memcached - Lua memcached client driver for the ngx_lua based on the cosocket API jayjanssen/myq_gadgets - Vario...Tags: Awesome, perl, frameworks, libraries, software
2507 days ago
Awesome perl frameworks, libraries and software - PART 5
robelix/sub2srt - subtitle converter reyjrar/graphite-scripts - A Collections of Scripts for Working with Graphite regilero/check_nginx_status - Nagios check for nginx status report omniti-labs/resmon - resmon motemen/App-htmlcat - redirect stdin to web browser moo...Tags: Awesome, perl, frameworks, libraries, software
2507 days ago