Results for "script"

Tags

  • R pretty scripts http://www.ncss.com/software/ncss/ncss-plots-and-graphs/ #R #Script #Plot #Idea #Graph

    Tags: R, Script, Plot, Idea, Graph

    2764 days ago

  • Useful perl script http://homepages.ulb.ac.be/~dgonze/SCRIPTS/scripts.html #Perl #Script #Resource

    Tags: Perl, Script, Resource

    2765 days ago

  • A perl script for mapping fasta formated sequences to multiple reference sequences using one of several alignment programs. http://seq.crg.es/download/software/Miro/doc/run_Mapping.html #Perl #Script

    Tags: Perl, Script

    2765 days ago

  • Finding Patterns in Biological Sequences

    In this report we provide an overview of known techniques for discovery of patterns of biological sequences (DNA and proteins). We also provide biological motivation, and methods of biological verification of such patterns. Finally we list publicly available tools and databases for pattern discov...

    Tags: Bioinformatics, Patterns, Tools, Book, Tutorial, Paper, Script, Algo

    2686 days ago

  • fineSTRUCTURE v2 & GLOBETROTTER

    Software available at this site FineSTRUCTURE version 2, a pipeline for running ChromoPainter and FineSTRUCTURE for population inference. A GUI is available for interpretation. Download from the Downloads page. FineSTRUCTURE R scripts, a facility for exploring the results when the GUI is un...

    Tags: Bioinformatics, Chromosome, Paint, R, Script

    2633 days ago

  • Ideoplot

    Simple ideogram plotting and annotation in R. Basic usage: Rscript Ideoplot.R --heatmap hm.bed --annotate annotations.bed --out ideogram.pdf -or- Rscript Ideoplot.R --annotate annotations.bed Options --ideobed, i A bed file of reference contig lengths/chromosome names --heatmap, -h ...

    Tags: Bioinformatics, Chromosome, Paint, R, Script

    2633 days ago

  • How to extract sequence from a multifasta file?

    Extract "Seq2" from the list below >Seq1GTGCACTAAGAAAAATAAAATTTGTTCTTTTAAGATAATCATTTCCTGGACGAATATCAATAGCAATAGAATAAGTCCAATCAAATGATTGCCGTGATGAACGAACTTGTAATTGTTGATAACTAGAACCATGCTGTAAACAAAATTTTGATGACCATTGTGGTCGACCTTCTTGTTGACGATGTAAACCATTTCCAACTCGCATAACACATGTATTATTACGCTGAGCATTATCGAAAGAAAGAAGAAGT...

    Tags: Bioinformatics, Fasta, Script

    2630 days ago

  • How to install Perl packages on servers?

    I am problem installing Perl module on cluster/server without root. Can you please recommend me a easy way or alternative way to install it.

    Tags: Bioinformatics, Perl, Server, Cluster, Packages, Modules, Install, Script

    2626 days ago

  • Data structure with R http://staff.washington.edu/jon/dsa-perl/dsa-perl.html #R #Data #Structure #Script #Perl

    Tags: R, Data, Structure, Script, Perl

    2568 days ago

  • Perl OneLiner http://userweb.eng.gla.ac.uk/umer.ijaz/bioinformatics/oneliners.html #Perl #Oneliner #NGS #Script

    Tags: Perl, Oneliner, NGS, Script

    2555 days ago