Which Bioinformatics Journals Do You Follow?
Which are your favorite bioinformatics journals? The ones that you check every month or so, or that you are subscribed to?Tags: Bioinformatics, Computational Biology, Education, Study, Journals, Publication
3321 days ago
Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3319 days ago
BINC Sample Question Paper !!!
BINC sample question paper for round ONE.Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3315 days ago
BINC Sample Question Paper !!!
BINC sample question paper round TWO.Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3315 days ago
BINC Sample Question Paper !!!
BINC sample question paper round THREE ...Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3315 days ago
BINC Sample Question Paper !!!
BINC sample question paper. Wish you all the best for BINC examination.Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3315 days ago
Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3314 days ago
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3277 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3260 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G",  ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3260 days ago