BOL

Results for "extract"

Tags

• • Jit@jit.aber

  

  perl -nle 'if (/^>/) { $sl = 0; print; next } next if ($sl >= 200); $_ = substr($_, 0, 200-$sl) if ($sl + length($_) > 200); $sl += length($_); print;' file.fa >new.fa #Perl #Extract #Fasta

  Tags: Perl, Extract, Fasta

  3612 days ago

• • Alok Prajapati@Alok

  

  Extract the numeric values from the multiple FASTA sequence file.

  I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...

  Tags: Extract, Number, Fasta, Coordinates

  3637 days ago

• • Jit@jit.aber

  

  Extract list of read ID from bam file: samtools view mbi.sorted.bam |perl -ne '/ID/ && print' > extractedID.sam #Extract #Ids #SAM #BAM #NGS

  Tags: Extract, Ids, SAM, BAM, NGS

  3625 days ago

• • Rahul Nayak@rahul

  

  Extract sequences by their ID from a fasta file. perl -ne 'if(/^>(\S+)/){$c=$i{$1}}$c?print:chomp;$i{$_}=1 if @ARGV' ids.txt sample1.fa #Extract #Sequences #IDs #Fasta #Perl #Trick #Oneliner

  Tags: Extract, Sequences, IDs, Fasta, Perl, Trick, Oneliner

  3151 days ago

• • Poonam Mahapatra@poonam

  

  #Extract all #Reads from #BAM file for a #region Chr10:18000-45500 using #samtools: samtools view input.bam "Chr10:18000-45500" > output.bam

  Tags: Extract, Reads, BAM, region, samtools

  2862 days ago

• • Radha Agarkar@radhaagarkar

  

  How to extract 50% of the reads?

  I would like to extract a subset of PE reads (50%) and store them in seperate files. It should be in both way "split by middle" or "random". Is there any way to achieve it?

  Tags: Reads, NGS, PE, Extract

  2808 days ago

• • Shruti Paniwala@shruti

  

  #Extract #tabbed info from #BAM file with samtools: samtools view test.bam|awk '{print $1 "\t" $2 "\t" $3 "\t" $4 "\t" $4+length($10)-1}' > file.xls

  Tags: Extract, tabbed, BAM

  2863 days ago

• • Poonam Mahapatra@poonam

  

  #Extract #Chromosome #Number And Start Position #Reads: samtools view bamfile.bam|awk '{print $3 "\t" $4 "\t" $4+length($10)-1}' > newfile.tab

  Tags: Extract, Chromosome, Number, Reads

  2857 days ago

• • Radha Agarkar@radhaagarkar

  

  Extract fasta sequence by Ids: perl -ne 'if(/^>(\S+)/){$c=grep{/^$1$/}qw(id1 id2)}print if $c' fasta.file #Perl #PerlOneliner #PerlTrick #Extract #Ids #Fasta

  Tags: Perl, PerlOneliner, PerlTrick, Extract, Ids, Fasta

  2779 days ago

• • Radha Agarkar@radhaagarkar

  

  Extract sequence by using Ids file (assuming one ids in a line): perl -ne 'if(/^>(\S+)/){$c=$i{$1}}$c?print:chomp;$i{$_}=1 if @ARGV' ids.file fasta.file #PerlTricks #PerlOneliner #Perl #Extract #Ids #

  Tags: PerlTricks, PerlOneliner, Perl, Extract, Ids

  2779 days ago

• « Previous
• 1
• 2
• 3
• Next »