Virtual Bioinformatics Online Tutorial
...bioinformatics training centres. Here I provide some of them: Virtual Institute of BioinformaticsNational University of Ireland , Ireland UNIX, GCG, SEQLAB and STADEN Tutorials...3949 days ago
3949 days ago
Frequent words problem solution by Perl
...ing.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4;...3280 days ago
Pattern Matching Problem Solution with Perl
...nome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="ATAT";my...3280 days ago
Genome Assembly Tools and Software - PART2 !!
...sp;is a parallel de novo genome assembler for small – mid sized genomes. Contrail 0.8.2 – Assembly of Large Genomes using Cloud ComputingContrail is a Hadoop based...2714 days ago
Awesome perl frameworks, libraries and software - PART 2
licheng/gccfilter - gccfilter is a perl filter to colorize and simplify (or expand) gcc diagnostic messages. gccfilt...1.0 for Perl kberov/PerlProgrammingCourse - A relatively full...e with support for embedded Perl ICGC-TCGA-PanCancer/PCAP-core ...2522 days ago
Awesome perl frameworks, libraries and software - PART 3
...nkakuev/list-cpp-warning-options - A simple Perl script that prints GCC warning options you can appl...miadns - Atomia DNS comotion/VSF - Varnish Security Firewall bgcngm/mtk-tools - Unpack /...2522 days ago
Awesome perl frameworks, libraries and software - PART 4
...e/dnscheck - DNSCheck code, DNS delegation quality checker. darold/pgcluu - PostgreSQL Cluster...kr-StatsD ernstsson/Arqua - Architectural quality analysis tool for GCC project qiaoxueshi/FLEXLoad...2522 days ago