Results for "my"
Pages
...uter for Cheap Using Grid Technology Career Advice for Computational Biology By Amjad-Ali Khoja at U. Texas. Proceedings of the National Academy of Sciences A Practical Guid...3963 days ago
A guide for complete R beginners :- R Syntax
...s printed to screen read.table(‘data.tsv’) This can always be stored, we call what it is stored in an ‘object’ mydata here mydata is an object of type data...3400 days ago
A guide for complete R beginners :- Getting data into R
...‘read.table’ function already. mydata Now mydata is a data frame with mult...of these are typed it will print to screen mydata$A mydata$B mydata$C #...function # if not already done so attach(mydata) boxplot(mydata$A, myda...3400 days ago
A guide for complete R beginners :- Installing R packages
...d the package. Installing packages without root access First, you need to designate a directory where you will store the downloaded packages. On my machine, I use the directory...3400 days ago
Reverse Complement Problem Solved with Perl
...Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = (&...(my $aa=0; $aa<=(length($string)-1); $aa++) { my $char=substr $string, $aa, 1;...3294 days ago
Frequent words problem solution by Perl
...t (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0... my $km=kmerMatch ($string, $myStr, $kmer); ...tring, $aa,$kmer; if ($myWin eq $myStr) { &...3294 days ago
Pattern Matching Problem Solution with Perl
...ears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="ATAT";my $kmer=lengt...my $myWin=substr $string, $aa,$kmer; if ($myWin eq $myStr) { &n...3294 days ago
Genome Assembly Tools and Software - PART2 !!
...er, 454, Solexa (Illumina), IonTorrent data and PacBio (the later at the moment only CCS and error-corrected CLR reads). It can be seen as a Swiss army knife of sequence assembly de...2728 days ago
Awesome perl frameworks, libraries and software - PART 2
...cs-r - Controls the R (R-project) interpreter through Perl brianwrf/myPadBuster - It is a Pytho...n+Perl script to exploit ASP.net Padding Oracle vulnerability. briandfoy/mycpan-indexer - (Perl) Ind...2536 days ago
Awesome perl frameworks, libraries and software - PART 3
...vice CindyLinz/Perl-AnyEvent-MySQL - Pure Perl AnyEvent socket implementation of MySQL client chorny/test-warn&n...test constructs - mostly for myself. robrwo/Perl-Rewrite&nbs...on a Plex Media Server joeyh/myrepos - Multiple Reposito...2536 days ago
