Comment on "Installing Porechop on Ubuntu !"
➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/a...3 PCR tail 1 76.7 75.9 PCR tail 2 79.3 77.4 1D^2 part 1 74.1 76.7 1D^2 part 2 91.2 80.6 Barcode 1 (reve...SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT 1D2_part_2_start: CTTCGTTCAGTTACGTAT...2165 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
EUROPE EURAXESS https://euraxess.ec.europa.eu/site/search?keywords=bioinformatics2171 days ago
Comment on "Various scholarships around the world !!"
...stone for our research fellows to be appointed as independent principal investigators at the prestig...nferred with Ph.D. degrees before August 31, 2018.* Researchers currently participating in the IBS researc...2178 days ago
Comment on "Ancestral sequence reconstruction steps !"
Parallelization of MAFFT for large-scale multiple sequence alignmentshttps://academic.oup.com/bioinformatics/article/34/14/2490/49160992180 days ago
Comment on "LAMSA: fast split read alignment with long approximate matches"
...cluster. [10] -R --max-reg [INT] Maximum allowed length of unaligned read part to trigger a bwt-based quer...[0.04] -T --read-type [STR] Specifiy the type of reads and set multiple parameters unless overriden. [nu...2182 days ago
2182 days ago
Comment on "Running Trinity on RNA-seq !"
...inotate. If your organism has an assembled genome, consider using the Trinity transcriptome assemblies for gene structure annotation using PASA....2182 days ago
Comment on "Installing Perl environment on Linux"
You migth need to install this sudo conda install -c bioconda perl-app-cpanminus2185 days ago
Comment on "Installing Perl environment on Linux"
...10 11.2 MB bioconda perl-app-cpanminus-1.7039 | 2 220 KB bioco...############ | 100% perl-app-cpanminus-1 | 220 KB | ##########...::UplevelFetching http://www.cpan.org/authors/id/D/DA/DAGOLDEN...I::EscapeFetching http://www.cpan.org/authors/id/E/ET/ETHER/UR...2185 days ago
Comment on "Installing Perl environment on Linux"
curl -L http://cpanmin.us | perl - --sudo App::cpanminus The above is installing the "zero configuration CPAN modules installer" called cpanm. (Can take several minutes to install - don't break the process) and after - simply: cpanm Foo cpanm Module::One cpanm Another::Module2185 days ago