Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.






Installing Porechop on Ubuntu !

  • Public
By Jit 2966 days ago Comments (1)
➜ Tools git:(master) ✗ git clone https://github.com/rrwick/Porechop.git Cloning into 'Porechop'... remote: Counting objects: 1579, done. remote: Total 1579 (delta 0), reused 0 (delta 0), pack-reused 1579 Receiving objects: 100% (1579/1579), 3.38 MiB | 1.62 MiB/s, done. Resolving deltas: 100% (869/869), done. Checking connectivity... done. ➜ Tools git:(master) ✗ cd Porechop ➜ Porechop git:(master) python3 setup.py install running install running build running build_py creating build creating build/lib creating build/lib/porechop copying porechop/version.py -> build/lib/porechop copying porechop/nanopore_read.py -> build/lib/porechop copying porechop/cpp_function_wrappers.py -> build/lib/porechop copying porechop/porechop.py -> build/lib/porechop copying porechop/misc.py -> build/lib/porechop copying porechop/adapters.py -> build/lib/porechop copying porechop/__init__.py -> build/lib/porechop Cleaning previous compilation: make clean rm -f porechop/src/adapter_align.o porechop/src/alignment.o Compiling Porechop: make -j 8 g++ -std=c++14 -Iporechop/include -fPIC -O3 -D NDEBUG -Wall -Wextra -pedantic -mtune=native -c -o porechop/src/adapter_align.o porechop/src/adapter_align.cpp g++ -std=c++14 -Iporechop/include -fPIC -O3 -D NDEBUG -Wall -Wextra -pedantic -mtune=native -c -o porechop/src/alignment.o porechop/src/alignment.cpp g++ -std=c++14 -Iporechop/include -fPIC -O3 -D NDEBUG -Wall -Wextra -pedantic -mtune=native -shared -Wl,-soname,porechop/cpp_functions.so -o porechop/cpp_functions.so porechop/src/adapter_align.o porechop/src/alignment.o running install_lib creating /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/version.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/nanopore_read.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/cpp_function_wrappers.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/porechop.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/misc.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/adapters.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop copying build/lib/porechop/__init__.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/version.py to version.cpython-36.pyc byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/nanopore_read.py to nanopore_read.cpython-36.pyc byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/cpp_function_wrappers.py to cpp_function_wrappers.cpython-36.pyc byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/porechop.py to porechop.cpython-36.pyc byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/misc.py to misc.cpython-36.pyc byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/adapters.py to adapters.cpython-36.pyc byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/__init__.py to __init__.cpython-36.pyc running install_egg_info running egg_info creating porechop.egg-info writing porechop.egg-info/PKG-INFO writing dependency_links to porechop.egg-info/dependency_links.txt writing entry points to porechop.egg-info/entry_points.txt writing top-level names to porechop.egg-info/top_level.txt writing manifest file 'porechop.egg-info/SOURCES.txt' reading manifest file 'porechop.egg-info/SOURCES.txt' reading manifest template 'MANIFEST.in' writing manifest file 'porechop.egg-info/SOURCES.txt' Copying porechop.egg-info to /home/urbe/anaconda3/lib/python3.6/site-packages/porechop-0.2.3-py3.6.egg-info running install_scripts Installing porechop script to /home/urbe/anaconda3/bin ➜ Porechop git:(master) porechop -h usage: porechop -i INPUT [-o OUTPUT] [--format {auto,fasta,fastq,fasta.gz,fastq.gz}] [-v VERBOSITY] [-t THREADS] [-b BARCODE_DIR] [--barcode_threshold BARCODE_THRESHOLD] [--barcode_diff BARCODE_DIFF] [--require_two_barcodes] [--untrimmed] [--discard_unassigned] [--adapter_threshold ADAPTER_THRESHOLD] [--check_reads CHECK_READS] [--scoring_scheme SCORING_SCHEME] [--end_size END_SIZE] [--min_trim_size MIN_TRIM_SIZE] [--extra_end_trim EXTRA_END_TRIM] [--end_threshold END_THRESHOLD] [--no_split] [--discard_middle] [--middle_threshold MIDDLE_THRESHOLD] [--extra_middle_trim_good_side EXTRA_MIDDLE_TRIM_GOOD_SIDE] [--extra_middle_trim_bad_side EXTRA_MIDDLE_TRIM_BAD_SIDE] [--min_split_read_size MIN_SPLIT_READ_SIZE] [-h] [--version] Porechop: a tool for finding adapters in Oxford Nanopore reads, trimming them from the ends and splitting reads with internal adapters Main options: -i INPUT, --input INPUT FASTA/FASTQ of input reads or a directory which will be recursively searched for FASTQ files (required) -o OUTPUT, --output OUTPUT Filename for FASTA or FASTQ of trimmed reads (if not set, trimmed reads will be printed to stdout) --format {auto,fasta,fastq,fasta.gz,fastq.gz} Output format for the reads - if auto, the format will be chosen based on the output filename or the input read format (default: auto) -v VERBOSITY, --verbosity VERBOSITY Level of progress information: 0 = none, 1 = some, 2 = lots, 3 = full - output will go to stdout if reads are saved to a file and stderr if reads are printed to stdout (default: 1) -t THREADS, --threads THREADS Number of threads to use for adapter alignment (default: 16) Barcode binning settings: Control the binning of reads based on barcodes (i.e. barcode demultiplexing) -b BARCODE_DIR, --barcode_dir BARCODE_DIR Reads will be binned based on their barcode and saved to separate files in this directory (incompatible with --output) --barcode_threshold BARCODE_THRESHOLD A read must have at least this percent identity to a barcode to be binned (default: 75.0) --barcode_diff BARCODE_DIFF If the difference between a read's best barcode identity and its second-best barcode identity is less than this value, it will not be put in a barcode bin (to exclude cases which are too close to call) (default: 5.0) --require_two_barcodes Reads will only be put in barcode bins if they have a strong match for the barcode on both their start and end (default: a read can be binned with a match at its start or end) --untrimmed Bin reads but do not trim them (default: trim the reads) --discard_unassigned Discard unassigned reads (instead of creating a "none" bin) (default: False) Adapter search settings: Control how the program determines which adapter sets are present --adapter_threshold ADAPTER_THRESHOLD An adapter set has to have at least this percent identity to be labelled as present and trimmed off (0 to 100) (default: 90.0) --check_reads CHECK_READS This many reads will be aligned to all possible adapters to determine which adapter sets are present (default: 10000) --scoring_scheme SCORING_SCHEME Comma-delimited string of alignment scores: match, mismatch, gap open, gap extend (default: 3,-6,-5,-2) End adapter settings: Control the trimming of adapters from read ends --end_size END_SIZE The number of base pairs at each end of the read which will be searched for adapter sequences (default: 150) --min_trim_size MIN_TRIM_SIZE Adapter alignments smaller than this will be ignored (default: 4) --extra_end_trim EXTRA_END_TRIM This many additional bases will be removed next to adapters found at the ends of reads (default: 2) --end_threshold END_THRESHOLD Adapters at the ends of reads must have at least this percent identity to be removed (0 to 100) (default: 75.0) Middle adapter settings: Control the splitting of read from middle adapters --no_split Skip splitting reads based on middle adapters (default: split reads when an adapter is found in the middle) --discard_middle Reads with middle adapters will be discarded (default: reads with middle adapters are split) (required for reads to be used with Nanopolish, this option is on by default when outputting reads into barcode bins) --middle_threshold MIDDLE_THRESHOLD Adapters in the middle of reads must have at least this percent identity to be found (0 to 100) (default: 85.0) --extra_middle_trim_good_side EXTRA_MIDDLE_TRIM_GOOD_SIDE This many additional bases will be removed next to middle adapters on their "good" side (default: 10) --extra_middle_trim_bad_side EXTRA_MIDDLE_TRIM_BAD_SIDE This many additional bases will be removed next to middle adapters on their "bad" side (default: 100) --min_split_read_size MIN_SPLIT_READ_SIZE Post-split read pieces smaller than this many base pairs will not be outputted (default: 1000) Help: -h, --help Show this help message and exit --version Show program's version number and exit

Comments

  • Jit 2966 days ago

    ➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa

    Loading reads
    /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta
    1,634,477 reads loaded


    Looking for known adapter sets
    10,000 / 10,000 (100.0%)
    Best
    read Best
    start read end
    Set %ID %ID
    SQK-NSK007 96.6 81.8
    Rapid 66.1 0.0
    SQK-MAP006 80.0 82.6
    SQK-MAP006 Short 76.9 76.0
    PCR adapters 1 82.6 78.3
    PCR tail 1 76.7 75.9
    PCR tail 2 79.3 77.4
    1D^2 part 1 74.1 76.7
    1D^2 part 2 91.2 80.6
    Barcode 1 (reverse) 76.0 78.6
    Barcode 2 (reverse) 79.2 80.0
    Barcode 3 (reverse) 80.0 75.0
    Barcode 4 (reverse) 80.0 77.8
    Barcode 5 (reverse) 73.1 76.9
    Barcode 6 (reverse) 76.0 76.9
    Barcode 7 (reverse) 79.2 79.2
    Barcode 8 (reverse) 81.5 76.0
    Barcode 9 (reverse) 76.0 76.0
    Barcode 10 (reverse) 76.0 78.6
    Barcode 11 (reverse) 79.2 80.8
    Barcode 12 (reverse) 80.0 83.3
    Barcode 1 (forward) 83.3 80.0
    Barcode 2 (forward) 80.0 80.0
    Barcode 3 (forward) 76.9 76.0
    Barcode 4 (forward) 80.8 76.9
    Barcode 5 (forward) 75.0 75.0
    Barcode 6 (forward) 76.9 76.9
    Barcode 7 (forward) 80.0 79.2
    Barcode 8 (forward) 76.9 76.9
    Barcode 9 (forward) 80.0 76.9
    Barcode 10 (forward) 77.8 79.2
    Barcode 11 (forward) 76.9 80.0
    Barcode 12 (forward) 79.2 79.2
    Barcode 13 (forward) 76.9 80.0
    Barcode 14 (forward) 76.0 74.1
    Barcode 15 (forward) 73.1 75.0
    Barcode 16 (forward) 76.0 79.2
    Barcode 17 (forward) 76.0 75.0
    Barcode 18 (forward) 76.9 78.6
    Barcode 19 (forward) 78.6 80.8
    Barcode 20 (forward) 80.0 79.2
    Barcode 21 (forward) 79.2 80.0
    Barcode 22 (forward) 79.2 80.0
    Barcode 23 (forward) 75.0 75.0
    Barcode 24 (forward) 80.8 76.0
    Barcode 25 (forward) 76.9 77.8
    Barcode 26 (forward) 80.0 77.8
    Barcode 27 (forward) 76.0 76.9
    Barcode 28 (forward) 80.0 77.8
    Barcode 29 (forward) 76.0 76.0
    Barcode 30 (forward) 80.0 76.9
    Barcode 31 (forward) 79.2 77.8
    Barcode 32 (forward) 76.0 79.2
    Barcode 33 (forward) 76.9 76.0
    Barcode 34 (forward) 76.0 79.2
    Barcode 35 (forward) 76.0 75.0
    Barcode 36 (forward) 76.0 76.0
    Barcode 37 (forward) 80.0 80.0
    Barcode 38 (forward) 76.0 80.8
    Barcode 39 (forward) 74.1 76.0
    Barcode 40 (forward) 79.2 76.0
    Barcode 41 (forward) 76.0 77.8
    Barcode 42 (forward) 76.0 80.0
    Barcode 43 (forward) 76.9 79.2
    Barcode 44 (forward) 76.0 75.0
    Barcode 45 (forward) 76.0 76.9
    Barcode 46 (forward) 79.2 76.0
    Barcode 47 (forward) 76.0 75.0
    Barcode 48 (forward) 79.2 76.0
    Barcode 49 (forward) 80.8 78.6
    Barcode 50 (forward) 75.0 76.9
    Barcode 51 (forward) 76.0 76.0
    Barcode 52 (forward) 76.9 79.2
    Barcode 53 (forward) 76.0 76.9
    Barcode 54 (forward) 76.9 80.0
    Barcode 55 (forward) 79.2 77.8
    Barcode 56 (forward) 80.0 76.0
    Barcode 57 (forward) 75.0 76.0
    Barcode 58 (forward) 75.0 75.0
    Barcode 59 (forward) 76.9 79.2
    Barcode 60 (forward) 75.0 76.9
    Barcode 61 (forward) 73.1 76.0
    Barcode 62 (forward) 76.9 76.0
    Barcode 63 (forward) 76.0 77.8
    Barcode 64 (forward) 81.5 79.2
    Barcode 65 (forward) 76.0 76.9
    Barcode 66 (forward) 76.0 76.9
    Barcode 67 (forward) 76.9 76.9
    Barcode 68 (forward) 79.2 79.2
    Barcode 69 (forward) 76.9 76.9
    Barcode 70 (forward) 76.9 76.0
    Barcode 71 (forward) 77.8 76.0
    Barcode 72 (forward) 80.0 76.0
    Barcode 73 (forward) 79.2 80.0
    Barcode 74 (forward) 77.8 76.9
    Barcode 75 (forward) 79.2 76.0
    Barcode 76 (forward) 80.0 79.2
    Barcode 77 (forward) 76.0 76.0
    Barcode 78 (forward) 80.0 80.8
    Barcode 79 (forward) 76.9 80.0
    Barcode 80 (forward) 76.9 76.9
    Barcode 81 (forward) 77.8 80.0
    Barcode 82 (forward) 77.8 75.0
    Barcode 83 (forward) 77.8 80.0
    Barcode 84 (forward) 75.0 75.0
    Barcode 85 (forward) 76.9 76.9
    Barcode 86 (forward) 76.0 76.0
    Barcode 87 (forward) 76.0 76.9
    Barcode 88 (forward) 80.8 76.0
    Barcode 89 (forward) 79.2 80.0
    Barcode 90 (forward) 75.0 74.1
    Barcode 91 (forward) 73.1 74.1
    Barcode 92 (forward) 75.0 76.9
    Barcode 93 (forward) 76.0 80.0
    Barcode 94 (forward) 75.0 76.0
    Barcode 95 (forward) 80.0 80.8
    Barcode 96 (forward) 79.2 76.0


    Trimming adapters from read ends
    SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
    SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
    1D2_part_2_start: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT
    1D2_part_2_end: CACCCAAGCAGACGCCAGCAATACGTAACT

    1,634,477 / 1,634,477 (100.0%)

    1,150,024 / 1,634,477 reads had adapters trimmed from their start (40,250,129 bp removed)
    419,580 / 1,634,477 reads had adapters trimmed from their end (6,338,306 bp removed)


    Splitting reads containing middle adapters
    1,634,477 / 1,634,477 (100.0%)

    1,202 / 1,634,477 reads were split based on middle adapters


    Outputting trimmed reads to stdout
    Done