Results for "PE"
Bio-Scripts
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2090 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s...2090 days ago
Installing pb-assembly on Linux !
...makedepend/1.0.5-foss-2016a bzip2/1.0...OpenBLAS/0.2.15-GCC-4.9.3-2.25-LA...1.0.4 intel/clusterstudio/inspector/2013.2...Time: 0:00:00 23.75 MB/s pyopenssl-18.0 100% |##############...2081 days ago
- ...greg200k-sv2.2.tar | tar xvf - % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 0 0...
2081 days ago
Perl script to create a consensus of nucleotide sequences !
...$H{$b}->[$B]||0) ($H{$a}->[$B]||0) || $prefOrder{$b} $prefOrder{$a} } qw/A T G C/ ]->[0]; } return @cons; } #reference https://www.perlmonks.org/bare/?node_id=5009...2079 days ago
- ...99 -O3 -Wall -Wmissing-prototypes -Wmissing-declarations -DNUP...99 -O3 -Wall -Wmissing-prototypes -Wmissing-declarations -DNUP...99 -O3 -Wall -Wmissing-prototypes -Wmissing-declarations -DNUP...99 -O3 -Wall -Wmissing-prototypes -Wmissing-declarations -I../...
2073 days ago
- ....9.tar.bz2&response-content-type=application%2Foctet-stream R...cram/misc.h htslib-1.9/cram/open_trace_file.c htslib-1.9/cra...air.sam htslib-1.9/test/xx#repeated.sam htslib-1.9/test/xx#r...ll -O2 -I. -fpic -c -o cram/open_trace_file.pico cram/open_tr...
2066 days ago
Installing Platypus on Ubuntu !
...-g -Wall -O2 -I. -c -o cram/open_trace_file.o cram/open_trace...ll -O2 -I. -fpic -c -o cram/open_trace_file.pico cram/open_tr...apv -O3 -Wall -Wstrict-prototypes -fPIC -I./ -Ic -I/home/urbe/...apv -O3 -Wall -Wstrict-prototypes -fPIC -I./ -Ic -I/home/urbe/...2066 days ago
- #! /usr/bin/Rscript ## Collect arguments args
2050 days ago
- ...he coverage script chr=$1 start=$2 end=$3 samtools depth deduped_MA605.bam > deduped_MA605.coverage awk '$1 ==...A605.coverage > chr1_MA605.coverage #awk '$1 == 2 {print $0}' deduped_MA605.coverage > chr2_MA605....
2050 days ago
