Results for "C"
Bio-Scripts
Generates a genome coverage plot with R
library(CoverageView) ##draw a coverage plot for a test case BAM file #get a BAM test file treatBAMfile2098 days ago
Generate simulated polyploid genome !
#Generate 3% divergence msbar -point 4 -count 16558 toy.fasta > toyheterozygous3percent.fasta #Cat both files cat toy.fasta toymutated3percent.fasta > toyheterozygous3percent.fasta #generated 50X of...2096 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2086 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print...:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom...$revcom =~ s/T/A/g; $revcom =~ s/G/C/g; $revcom =~ s/C/G/g; pr...ry again ... \n\n"; # Make a new copy of the DNA (see why we sav...2086 days ago
Installing pb-assembly on Linux !
...M4/1.4.17-GCCcore-4.9.3 bzip2/1.0.6-foss-...netCDF-Fortran/4.4.3-foss-2016a F...3.1.0-intel-2013.0.028 GraphicsMagick/1.3.23-foss-2016a...ime: 0:00:00 20.71 MB/s asn1crypto-0.2 100% |##############...2077 days ago
- ...asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001/git-sym.git fata...n /home/users/j/n/jnarayan/FALCON-examples/.git/ remote: Enu...ovo_asm) [jnarayan@hmem00 ~]$ cd FALCON-examples/ (denovo_as...'/home/users/j/n/jnarayan/FALCON-examples/.git/git-sym-local...
2077 days ago
Perl script to create a consensus of nucleotide sequences !
use strict; use warnings; my @instances = qw ( AAAAA ATCGA ATAAA ); my @instances2 =...b consensus{ my @mi = @_; chomp(@mi); my $motif_count=0...# Initialize the base counts. my %h = ( a=>0...]->[0]; } return @cons; } #reference https://...2075 days ago
- #http://www.nupack.org/downloads/source ➜ tools git:(master) ✗ cd nupack3.0.6 ➜ nupack3.0.6 git:(master) ✗ make make -C src/ make[1]: Entering direc...~~~~~~~~~~~~~~~~~~~~~~~ init.c:1051:5: warning: ignoring ret.../shared -I../../../src/shared/constants -c -o min.o min.c...
2069 days ago
- ...ase-asset-2e65be.s3.amazonaws.com)|52.216.82.208|:443... conn...1.9/faidx.c htslib-1.9/hfile.c htslib-1.9/hfile_gcs.c htsl..._exp.sam htslib-1.9/test/sam.c htslib-1.9/test/tabix/ htsl...vcf_sweep.pico vcf_sweep.c gcc -g -Wall -O2 -I. -fpic -c -...
2062 days ago
Installing Platypus on Ubuntu !
...) ➜ Tools git:(master) ✗ git clone https://github.com/andyrimmer/Platypus.git Cloning into 'Platypus'... rem.... -c -o cram/cram_samtools.o cram/cram_samtools.c gcc -g -W...running build_ext skipping 'cython/htslibWrapper.c' Cython...2062 days ago
