Results for "N"
Bio-Scripts
Generates a genome coverage plot with R
library(CoverageView) ##draw a coverage plot for a test case BAM file #get a BAM test file treatBAMfile2110 days ago
Generate simulated polyploid genome !
#Generate 3% divergence msbar -point 4 -count 16558 toy.fasta > toyheterozygous3percent.fasta #Cat both files cat toy.fasta toymutated3percent.fasta > toyheterozygous3percent.fasta #generated 50X of I...2108 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2098 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse.../G/C/g; $revcom =~ s/C/G/g; print "Here is the reverse complem...the DNA (see why we saved the original?) $revcom = reverse $DNA;...2098 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail -...oost/1.49.0-goolf-1.4.10-Python-2.7.3...ncurses/5.9-GCC-4.7.2 Eigen/3....pygimli/1.0.6-Python-3.6.3-foss2016a GMP/6.1.1-fo...conda-forge libgfortran: 3.0.0-1...2089 days ago
- (denovo_asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001/git-sym.git fatal: dest...b-cdunn/FALCON-examples.git Initialized empty Git repository....git/git-sym-local/cache -> in dir 'run/greg200k-sv2/' '......fasta greg200k-sv2.2/orig.links/sv2.fasta greg200k-sv2.2/o...
2089 days ago
Perl script to create a consensus of nucleotide sequences !
use strict; use warnings; my @instances = qw ( AAAAA ATCGA ATAAA ); my @instances2 = qw ( AAAAA AACGA ATAAA AGAAA AGAAA); print consensus(@instances),"\n";..._; chomp(@mi); my $motif_count=0; my @words =(); my...$H{G}}, $g; } my @cons = (); my %prefOrder = (...2087 days ago
- #http://www.nupack.org/downloads/source ➜ tools git:(master) ✗ cd nupack3.0.6 ➜ nupack3.0.6 git...’, declared with attribute warn_unused_result [-Wunused-resul...variable ‘pair_flag’ set but not used [-Wunused-but-set-vari...ribute warn_unused_result [-Wunused-result] scanf("%s",...
2081 days ago
- ...m=AWS4-HMAC-SHA256&X-Amz-Credential=AKIAIWNJYAX4CSVEH53A%2F20...lib-1.9/bgzip.c htslib-1.9/config.mk.in htslib-1.9/configur...slib-1.9/kfunc.c htslib-1.9/knetfile.c htslib-1.9/kstring.c...) ✗ ls bcf_sr_sort.c hfile_internal.h knetfile.c sam.c...
2074 days ago
Installing Platypus on Ubuntu !
...Tools git:(master) ✗ git clone https://github.com/andyrimmer/Platypus.git Cloning into 'Platypus'... remote.../cram_encode.o cram/cram_external.o cram/cram_index.o cram/cr...iler_compat -Wl,--sysroot=/ -fno-strict-aliasing -g -O2 -DNDE...2074 days ago
