Results for "miRNA target gene"
Bio-Scripts
bash script to extract sequence by ids !
Use a Perl one-liner, grep and seqtk subseq to extract the desired fasta sequence...GI_novel_T016141 Solyc03g007600.3.1 ACGTACGTACGTACGTACGTACG EOF cat > gene_ids.txt ids_gene_ids.tsv # Select ids that...866 days ago
Identify genome-wide synteny with LASTZ alignment
#This is the walkstrough how to identifiy genome-wide synteny markers based on LASTZ ali...nnet.axt AAChr1.txt.sizes FFChr1.txt.sizes -tPrefix=target. -qPrefix=query. chr1.chain.f...rawsynteny.pl chr1.chain.filter.tnet.synnet.axt.maf targ...560 days ago
- #!/usr/bin/env Rscript library(RCircos) # usage: Rscript make_circos.r # parse args args = commandArgs(trailingOnly=TRUE) sv.file
342 days ago
- #You typically need the correspondin...about the #features (such as genes) in the genome, including th...extract information about the gene locations. #Use the gene loc...uence(gff_file, genome_fasta, gene_id): # Step 1: Parse the...d(genome_fasta, 'fasta') gene_start, gene_end = gene_locati...
137 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO.../to/your/file.gff'; my $genome_fasta = 'path/to/your/genome.fasta'; # Gene ID to extract my $gene_id_to_extract = 'your_gene_id...137 days ago
- « Previous
- 1
- 2
- 3
- Next »
