Results for "Data Mining Algorithm"
Bio-Scripts
Install Parrot Virtual Machine !
#Parrot is a virtual machine designed to efficiently compile and execute bytecode for dynami...les and other build files...........done. gen::config_pm - Record configuration data for...1564 days ago
- # list sample names & download URLs. sample_links = {"ERR458493": "https://osf.io/5daup/d...SAMPLES=sample_links.keys() # download yeast rna-seq data f...e download_all: input: expand("rnaseq/raw_data/{sam...
1543 days ago
- set -e echo "Running reapr version 1.0.18 pipeline:" echo "/home/urbe/Tools/Reapr_1.0.18...25 WadinetaGapFilled.gapfilled.iteration1.fa /home/urbe/DATA/O...160226.HiSeq2000.FCB.lane1.gcap_dev.R1.fastq /home/urbe/DATA/Orig...
2126 days ago
Perl script to find palindromic pattern !
#!/usr/bin/perl use strict; use warnings; use strict; my %invert; @invert{ qw[ A C G T ]...1-$pals), substr( $in, $p1-$pals, ($pals+1)*2 ), $p1-$pals; } } __DATA__ A...2126 days ago
- ...run using Google cloud dataproc command...fter the -- will be passed to dataproc --clust...Checks that all data in the input files appear to have...concordance between genotype data of one samples in each of two VCFs...
2102 days ago
- ➜ upgrade_oh_my_zsh Updating Oh My Zsh remote: Counting objects: 484, done. remote: Compr...lugins/emoji/README.md | 6 +- plugins/emoji/emoji-data.txt...
2102 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is...e complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorithm, and the reverse complement w...2070 days ago
- (denovo_asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001/git-sym.git fatal:...les/git-sym.makefile 'greg200k-sv2.2' curl -L https://downloads.pacbcloud.com/public/data/git-...
2061 days ago
- ➜ Tools git:(master) ✗ wget https://github.com/samtools/...4339773/f2f10d8a-8a73-11e8-89f4-07e1d9d77b17?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Creden...4339773/f2f10d8a-8a73-11e8-89f4-07e1d9d77b17?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Creden...
2046 days ago
- #! /usr/bin/Rscript ## Collect arguments args
2031 days ago
