Perl onliner to check the ids in two files !
perl -lane 'BEGIN{open(A,"ids2.txt"); while(){chomp; $k{$_}++}} if (defined($k{$F[0]})) {print "$_\t$F[0]\t1"} else {print "$_\tNA\t0"}; ' ids1.txt > aaa.xls978 days ago
Extract fasta header with ids !
...rep "227859" | awk '{print $2}' > all_real_ids.txt minimap2 -t 36 -k19 -w5 -A1 -B2 -O3,13 -E2,1 -s200 -z200 -N50 --min-occ-floor=100 finaal_output.fasta finaal_output.fasta > finaal_self_a...928 days ago
bash script to extract sequence by ids !
...n.fasta BGI_novel_T016313 Solyc03g025570.2.1 TTCAAGTGTTAGTTTCACATCAT >BGI_novel_T018109 Solyc03g080075.1.1 GCAAGGGAAAGAAGTATTACTAG >BGI_nove...BGI_novel_T016697 Solyc03g033550.3.1 CTGACGTATACAATTAAGCCGCG >BGI_novel_T018109...875 days ago
Identify genome-wide synteny with LASTZ alignment
...mall -lib custom.TE.lib_for_rice.fa AAChr1.txt RepeatMasker -pa 40 -...using LASTZ and Chain/Net lastz AAChr1.txt FFChr1.txt K=2200 L=6...nNet chr01.chain.filter -minSpace=1 AAChr1.txt.sizes FFChr1.txt.size....synnet.axt.maf -n 0 -m 3 -t target.AAChr1 -q query.FFChr1 -o syn.fi...569 days ago
Perl script for chi-squared test !
...use strict; use warnings; use Getopt::Long; use FAlite; # sanity checks die "Usage: chidi.pl \n" if (!$ARGV[1]); my @dinucs = qw (AA AC AG AT CA CC CG CT GA GC GG...463 days ago
Raku script to calculate GC content !
...t = $sequence.comb(//).elems; my $total-bases = $sequence.chars; return $gc-count / $total-bases * 100; } my $dna_sequence = "ATGCGCTAAAGCGCGCGCCTTACGCGCGCGCGC"; my...163 days ago
Perl script to calculate GC content !
...$sequence); my $gc_content = ($gc_count / $total_bases) * 100; return $gc_content; } # Example usage: my $dna_sequence = "ATGCGCTAAAGCGAGCGAAGCGCTAGATCGATCGATCGATCGATCGATC...148 days ago