Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2071 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~...2071 days ago
2054 days ago
Installing Platypus on Ubuntu !
...Processing triggers for libc-bin (2.27-3ubuntu1) ... Processi...d mkdir -p -m 755 /usr/local/bin /usr/local/include /usr/local...T’ KHASH_MAP_INIT_INT(i, ti_binlist_t) ^~~~~~~~~~~~~~~~~~....7/variantcaller.so mkdir -p bin cp src/build/*/*.so bin/ cp...2047 days ago
1579 days ago
2032 days ago
2032 days ago
Perl script to split fasta sequence and create overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2000 days ago
Perl script to count occurrence of a character !
#!/usr/bin/env perl # -*- coding: utf-8 -*- #!/usr/bin/perl use strict; use warnings; my %count_of; while ( ) { my @val = split "\t", $_; #my ( $word) = m/(\w+)/; $co...1928 days ago
1790 days ago