Perl script to calculate GC content !
...equence); my $gc_content = ($gc_count / $total_bases) * 100; return $gc_content; } # Example usage: my $dna_sequence = "ATGCGCTAAAGCGAGCGAAGCGCTAGATCGATCGATCGATCGATCGAT...155 days ago
Perl script for six frame translation !
...ranslated_seq; if ($frame > 0) { $translated_seq = $sequence->translate(-frame => $frame)->seq; } else { # If frame is negative, reverse and complement t...153 days ago
Raku script to find repeats in sequences !
...any(@repeats) { @repeats.push($substring); } } return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-r...153 days ago
Python script to find repeats in the DNA sequence !
...ring) > 1 and substring not in repeats: repeats.append(substring) return repeats # Example usage genome_sequence = "ATCGATCGATCGATCG" result = find_repeat...153 days ago
Raku script to find microsatellites in DNA fragments !
...ellites.push($substring); } } } return @microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = fi...153 days ago