Results for "2%"
Bio-Scripts
Install BLAST in Ubuntu/Linux and Window !
#On ubuntu sudo apt-get install ncbi-blast+ #Ubuntu Conda installation conda install -c bioconda blast #Windows installation First: Download ftp://ftp.ncbi...1183 days ago
Parse a genbank file using regular expressions
#! /usr/local/bin/perl -w $genbank = "genbank_file.txt"; open (GENBANK, $genbank) || die "cannot open $gb_report for reading: $!"; # Flag for multiline trans...2953 days ago
BioPerl to convert between sequence formats from Fasta to Genbank
#!/usr/local/bin/perl -w # Sequence formats to choose: Fasta, EMBL. GenBank, Swissprot, PIR and GCG use Bio::SeqIO; $inFile = "BRCA2.fa"; $in = Bio::SeqI...2952 days ago
Retrieve NCBI GenBank records with a range of accession numbers
#!/usr/bin/perl #FILE: ncbi_search.pl #AUTH: Paul Stothard (paul.stothard@gmail.com) use warnings; use strict; use Getopt::Long; use LWP::Simple; use URI::...2952 days ago
A multilayer perceptron (MLP) neural network in Perl
#!/usr/local/bin/perl -w #################################################### #MLP neural network in Perl Original source code by Phil Brierley #Translated into...2952 days ago
Extract a random sequence from a file
#!/usr/local/bin/perl -w use strict; use warnings; use autodie; use List::Util qw/ shuffle /; my $outputfile = 'randomoutput.txt'; open my $in_fh, '',...2951 days ago
- #!/usr/bin/env perl use strict; use warnings; use LWP::Simple; use XML::XPath; use XML::XPath::XMLParser; # Use DAS of UCSC to fetch specific sequence by it...
2946 days ago
Perl program to implement sliding window !
#!/usr/bin/perl -w my $filename = 'data.txt'; open(my TR, '2950 days ago
- #!/usr/bin/perl # make three strings of nucleotides $dna1 = “AAAAAAAAAAAAAAATGAAAAAAAAAAAAAAAA”; $dna2 = “AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA”; $dna3 = “ATGAA...
2945 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2945 days ago
