Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3358 days ago
Skills: Programming (Python, Linux, Bash, R), Computational Biology, NGS technologies, WGS, RNA Seq, Repeats, Variant Calling
1192 days ago
Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Upgrade, R 3.2.0
3357 days ago
Affy has acquired Eureka Genomics for 15M $
Affymetrix Acquires Assets Of Eureka Genomics Corporation To Provide High Throughput And Economical Crop And Animal Genotyping http://www.thestreet.com/story/13151062/1/affymetrix-acquires-assets-of-eureka-genomics-corporation-to-provide-high-throughput-and-economical-crop-and-animal-genotyping....Tags: Bioinformatics, Computational Biology, Education, Affymetrix, Acquires, Eureka, Genomics, Corporation
3325 days ago
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3321 days ago
Tags: Bioinformatics, Computational Biology, Genomics, RNAseq, NGS, Chromosome, Ryan E. Mills
3319 days ago
Tags: Bioinformatics, Computational Biology, Genomics, RNAseq, NGS, omics, Comparative Genomics, Parasite, Evolution, Nicolas Corradi
3319 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G",  ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3304 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3304 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3304 days ago