Results for "C"
Pages
Reverse Complement Problem Solved with Perl
...info/problems/1b/ #Find the reverse complement of a DNA string.#Giv...attern.#Return: Pattern, the reverse complement of Pattern.use stric...g="";my %hash = ( "C" => "G", &nbs..., 1; #print $hash{$char}; $final...3251 days ago
Frequent words problem solution by Perl
...quent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";..."$myStr\n"; my $km=kmerMatch ($string, $myStr, $kmer);&nb...r\n"; $count++; }}re...3251 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string....s as a substring. Use 0-based indexing.use strict;use warnings;my $string="GAT...kmerMatch ($string, $subStr, $kmer);sub kmerMatch { #Check the exact matching...3251 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl2333 days ago
Genome Assembly Tools and Software - PART2 !!
...ly take a file of short sequence reads and a file of quality-value as the input. Since the quality-value file for t...It aims “only” at closing the gap between pairs o...nd scaffolding Illumina sequencing data of microbial communit...n reasonable time with modest computing resources. Our evalua...2685 days ago
Awesome perl frameworks, libraries and software - PART 2
licheng/gccfilter - gccfilter is a perl filter to colorize and simplify (or expand) gcc diagnostic messages. gccfilter is partic...l - Box2D for perl Ovid/Corinna - Generate Perl cl...client - Home of the official MetaCPAN Perl API client....2493 days ago
Awesome perl frameworks, libraries and software - PART 3
...ilder/formbuilder - Perl CGI::FormBuilder module for generating, validating, and processing HTML forms fastly/fast...nbsp;http://jupyter.org/ PerlChina/HeadFirstMoose - 使用P...doy/parse-keyword - DEPRECATED: write syntax extensions...2493 days ago
Awesome perl frameworks, libraries and software - PART 4
...Munin openresty/lua-resty-memcached - Lua memcached clien...amp; sudo apt-get install -y ec2-expire-snapshots rpetrich/o...01 deepakdaswani/whatsapp_discover - "Whatsapp Discover...ubble cross platform hluk/vimColorsToQtCreator - Conver...2493 days ago
Awesome perl frameworks, libraries and software - PART 5
...belix/sub2srt - subtitle converter reyjrar/graphite-scripts - A Collections of...bsp;- resmon motemen/App-htmlcat - redirect stdin to we...imple and dumb file system watcher mhop/fhem-mirror - B...one) at some point. jasonhancock/nagios-puppetdb - Nag...2493 days ago
- As I mentioned earlier, I will keep on posting one Python script per day to introduce you to Python programming. Whether yo...e language, and has a very straightforward syntax. The simplest directive in Python is the "print"...
2182 days ago
