Extract the numeric values from the multiple FASTA sequence file.
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...Tags: Extract, Number, Fasta, Coordinates
3640 days ago
How to extract 50% of the reads?
I would like to extract a subset of PE reads (50%) and store them in seperate files. It should be in both way "split by middle" or "random". Is there any way to achieve it?Tags: Reads, NGS, PE, Extract
2810 days ago