BOL

Results for "Fasta"

Tags

• • Abhimanyu Singh@abhimanyu

  

  fastq to fasta convertor $ sed -n '1~4s/^@/>/p;2~4p' test.fastq > test.fasta #Convert #Fasta #Fastq #fa #fq

  Tags: Convert, Fasta, Fastq, fa, fq

  2543 days ago

• • Neelam Jha@neelam

  

  Delete space from FASTA header: perl -pe 's/>\S+\K.+//' < file.fasta > new_file.fasta #PerlOneLiner #Trick #Perl #Space #Fasta

  Tags: PerlOneLiner, Trick, Perl, Space, Fasta

  2971 days ago

• • Poonam Mahapatra@poonam

  

  How to count the occurance of letters in fasta file?

  I received a new genome to annotated. I need your help to quickly count the occurance of all the letters in fasta file.

  Tags: Fasta, Count, Letters, ATGC, N, Others, Script

  2957 days ago

• • Anjana@anjana

  

  Quick way to calculate length of multiple fasta file!!

  I am using this perl code right nowadays.#!/usr/bin/perl use warnings; use strict;open(FASTA, "<", seq.fa) or die("Can't open\n"); my %singleLineSequences; my $sequence_id; while(){ my $line = $_; chomp($line); if ($line =~ m/^>(\S+)/){ $sequence_id = $1; $s...

  Tags: Fasta, Size, Length, NGS, Sequence

  2858 days ago

• • Radha Agarkar@radhaagarkar

  

  Extract fasta sequence by Ids: perl -ne 'if(/^>(\S+)/){$c=grep{/^$1$/}qw(id1 id2)}print if $c' fasta.file #Perl #PerlOneliner #PerlTrick #Extract #Ids #Fasta

  Tags: Perl, PerlOneliner, PerlTrick, Extract, Ids, Fasta

  2780 days ago

• • Shruti Paniwala@shruti

  

  Extract a fasta sequence from multifasta file: samtools faidx multitest.fa and then samtools faidx multitest.fa fasta_id > out.fa #Samtools #Fasta #Extract #Multifasta

  Tags: Samtools, Fasta, Extract, Multifasta

  2740 days ago

• • Neelam Jha@neelam

  

  How to extract sequence from a multifasta file?

  Extract "Seq2" from the list below >Seq1GTGCACTAAGAAAAATAAAATTTGTTCTTTTAAGATAATCATTTCCTGGACGAATATCAATAGCAATAGAATAAGTCCAATCAAATGATTGCCGTGATGAACGAACTTGTAATTGTTGATAACTAGAACCATGCTGTAAACAAAATTTTGATGACCATTGTGGTCGACCTTCTTGTTGACGATGTAAACCATTTCCAACTCGCATAACACATGTATTATTACGCTGAGCATTATCGAAAGAAAGAAGAAGT...

  Tags: Bioinformatics, Fasta, Script

  2627 days ago

• • Jit@jit.aber

  

  Get the fasta sequence of the coordinates http://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html #Fasta #Bed #Coordinates #Bedtools

  Tags: Fasta, Bed, Coordinates, Bedtools

  2607 days ago

• • Jit@jit.aber

  

  To add something to end of all header lines: $ sed 's/>.*/&WHATEVERYOUWANT/' file.fa > outfile.fa #Add #Fasta

  Tags: Add, Fasta

  2563 days ago

• • Jit@jit.aber

  

  To clean up a fasta file so only first column of the header is outputted:$ awk '{print $1}' file.fa > output.fa #Sed #Clean #Header #Fasta

  Tags: Sed, Clean, Header, Fasta

  2563 days ago

• « Previous
• 1
• 2
• 3
• 4
• 5
• 6
• 7
• 8
• Next »