2157 days ago
2930 days ago
2930 days ago
Find and replace ambiguous characters in fasta file with Perl and Bioperl
#!/usr/bin/perl -w my $usage="\nUsage: $0 [-h] [-m char] [fastaFileName1 ...]\n". " -h: help\n". " -m: missing character\n". "Print out the name of...2927 days ago
2923 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2922 days ago
2922 days ago
Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman...2919 days ago
Perl script to find the absolute "full" path of the file !
#!/usr/bin/perl use Cwd; my $this_file_full_path = Cwd::abs_path(__FILE__); print "$this_file_full_path\n"; use Cwd qw/ realpath /; ## $0; this script my $path = realpath($0); print $path;2892 days ago
Genetic Algorithms demonstration with word DNA in Perl
...opulation; # population size my @parent_population; my @new_population; my $total_parent_slots = 1; while ($total_parent_slots) { # find out how many parent slots are...2385 days ago