Bash script to get intergenic region from genome files !
#For the intergenic region, we will require the size of the chromosomes. wget http://xxx.chrom.sizes cat xxx....xxx.chrom.sizes gunzip -c genome_file.gtf.gz | awk 'BEGIN{OFS="\t";} $3=="gene" {pri...1368 days ago
Install and set up i-adhore for synteny and wgd analysis ! -- step by step --
#Need to download i-adhore-3.0.01.tar.gz from https://wdiceryfd...34") -- Configuring done -- Generating done -- Build files ha...t src/CMakeFiles/i-adhore.dir/Gene.cpp.o [ 63%] Building CXX ob...conda3/envs/wgd/./API/iADHoRe/gene.pm -- Installing: /home/urbe...stset/datasetI/arath_2_3_beta/genes.txt...1206 days ago
bash script to extract sequence by ids !
Use a Perl one-liner, grep and seqtk subseq to extract the desired fasta sequences: # Create test input:...I_novel_T016141 Solyc03g007600.3.1 ACGTACGTACGTACGTACGTACG EOF cat > gene_ids.txt ids_gene_ids.t...825 days ago
301 days ago
96 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF fi...to/your/file.gff'; my $genome_fasta = 'path/to/your/genome.fasta'; # Gene ID to extract my $gene_id_to...96 days ago