BOL

Log in

Our Sponsors


Download BioinformaticsOnline(BOL) Apps in your chrome browser.


Results for "Number"

Tags

  • Alok Prajapati

    Extract the numeric values from the multiple FASTA sequence file.

    I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...

    Tags: Extract, Number, Fasta, Coordinates

    3648 days ago

  • Jit

    Count the total number of lines in a file. my $total=@{[<INFILE>]}; #Perl #Count #Number #Total #File

    Tags: Perl, Count, Number, Total, File

    3619 days ago

  • Jit

    Count the number of "pattern" occurrence in a file grep -o 'pattern' anc.annots.gff | wc -l #Linux #grep #Count #Number #Occurrence

    Tags: Linux, grep, Count, Number, Occurrence

    3618 days ago

  • Jit

    To count number of fasta entries, I use: grep -c '^>' mySequences.fasta #Perl #Count #Number #Fasta #Linux #Grep

    Tags: Perl, Count, Number, Fasta, Linux, Grep

    3578 days ago

  • Rahul Nayak

    Count the number of sequences in fastaq file. grep -c '^@' sample1.fq #Fastaq #Count #Number #Grep #Dirty #Oneliner #NGS

    Tags: Fastaq, Count, Number, Grep, Dirty, Oneliner, NGS

    3162 days ago

  • Poonam Mahapatra

    #Extract #Chromosome #Number And Start Position #Reads: samtools view bamfile.bam|awk '{print $3 "\t" $4 "\t" $4+length($10)-1}' > newfile.tab

    Tags: Extract, Chromosome, Number, Reads

    2868 days ago

  • Jit

    PureCN: copy number calling and SNV classification using targeted short read sequencing

    This package estimates tumor purity, copy number, and loss of heterozygosity (LOH), and classifies single nucleotide variants (SNVs) by somatic status and clonality. PureCN is designed for targeted short read sequencing data, integrates well with standard somatic variant detection and copy number...

    Tags: PureCN, copy, number, calling, SNV, classification, targeted, short, read, sequencing

    2098 days ago

  • Rahul Nayak

    Add number in fasta header $ awk '/^>/{$0=$0"_"(++i)}1' infile.fa #fasta #header #add #number #count

    Tags: fasta, header, add, number, count

    1964 days ago

  • Radha Agarkar

    EXCAVATOR: detecting copy number variants from whole-exome sequencing data

    EXCAVATOR, for the detection of copy number variants (CNVs) from whole-exome sequencing data. EXCAVATOR combines a three-step normalization procedure with a novel heterogeneous hidden Markov model algorithm and a calling method that classifies genomic regions into five copy number states. We vali...

    Tags: EXCAVATOR, detect, copy, number, variants, whole-exome, sequencing, data

    1950 days ago

  • Neelam Jha

    ClinCNV: Detection of copy number changes in Germline/Trio/Somatic contexts in NGS data

    ClinCNV detects CNVs in germline and somatic context in NGS data (targeted and whole-genome). We work in cohorts, so it makes sense to try ClinCNV if you have more than 10 samples (recommended amount - 40 since we estimate variances from the data). By "cohort" we mean samples sequenced ...

    Tags: ClinCNV, Detection, copy, number, changes, Germline, Trio, Somatic, NGS, data

    1572 days ago

Powered by Elgg