2926 days ago
Perl to print indivisual nucleotide from a sequence!
#!/usr/bin/perl use strict; use warnings; my $string = "ATGCTTGCGT?AAATG??CT?GCGTA"; my @chars = split("", $string); print "First character: $chars[0]\n";2926 days ago
2922 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2921 days ago
2921 days ago
Generating a random string with Perl
#!/usr/bin/perl # This function generates random strings of a given length sub generate_random_string { my $length_of_randomstring=shift;# the length of #...2919 days ago
Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-...2917 days ago
Count GC Content in nucleotide sequence with Perl
#!/usr/bin/perl -w ### Usage: get_gc_content.pl ### #-----------------------------------------------------...2917 days ago
Implementation of biological random mutation with Perl
#!/usr/bin/perl -w use strict; use warnings; #sequence for a better recognition my $DNA="AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ n";...2913 days ago
Perl script to generate a random psuedo DNA sequence !
#!/usr/bin/perl print "Enter a number of nucleotides: \n"; chomp ($N = ); @b=qw/A T G C/;print ">Genome\n";while($l2895 days ago