Compress and decompress the sequence with perl
use strict; use warnings; my @char; while () { @char = split //; } comp(\@char); #--------------------- my $com= "r0a3m4a4j0"; my @com = split //, $com; dcomp (\@com); #dcomp sub here sub dcomp { my ($com_ref)=@_; my @com=@$com_ref; my $car; for (my $aa=0; $aa2538 days ago
2536 days ago
Extract the fastq sequence with range in Perl
use Bio::DB::Fasta; open(POSITIONS,"positions.txt"); while(){ chomp; my ($seqName,$begin,$end) = split(/\s/); my $db = Bio::DB::Fasta->new('allGenomeContacted.fa'); my $seq = $db->seq("$seqName", $begin => $end); print "$seq\n"; } close(POSITIONS);2491 days ago
Convert newline formated sequence into fasta format with perl
use strict; use warnings; my $filename = $ARGV[0]; open(my $fh, '2393 days ago
Extract fasta sequence with Ids with Bash script
#!/bin/bash while IFS='' read -r line || [[ -n "$line" ]]; do echo "Text read from file: $line" samtools faidx ONT.fasta $line > $line.faa done < "$1"2377 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidops...2348 days ago
Insert the sequence at desire location in multi-fasta file with Perl
#!/usr/bin/perl use warnings; use strict; use Bio::SeqIO; use Bio::Seq; use File::Copy; #ARGV[0] should be in following format --- Keep the coordinate sorted by...2337 days ago
Create genome scaffolding with Perl
#!/usr/bin/perl use warnings; use strict; use English; use Pod::Usage; ## uses pod documentation in usage code use Getopt::Long qw(:config auto_version auto_help...2332 days ago
Plot the clock using Lastz -gerenal outfile
use strict; use warnings; use Statistics::R ; use List::Util qw(sum); #Usage perl clockPlot.pl Palindrome.palfc 1500 my $R = Statistics::R->new() ; $R->startR ;...2322 days ago
Perl script to convert fastq to fasta file
#!/usr/bin/env perl use strict; use warnings; use Bio::Factory::EMBOSS; my $usage = "perl $0 in.fq out.fa"; my $infile = shift or die $usage; my $outfile = s...2274 days ago