2810 days ago
Tools to detect synteny blocks regions among multiple genomes
...om/gbe/article/8/8/2442/2198198/Novel-Insights-into-Chromosome-Evolution-in-Birds , http://science.sciencemag.org/content/346/6215/1311). But the puzzle remains open, how to correctl...2604 days ago
CABOG: Celera Assembler with Best Overlap Graph
...of letters per read that modern sequencers provide. What these programs do is often described as a scaled up version of a family solving a jigsaw puzzle. The CABOG software was the...2541 days ago
Foldit: Solve Puzzles for Science
Foldit is an online puzzle video game about protein folding. It is part of an experimental research project developed by the University of Washington, Center for Gam...2321 days ago
Phylogenetic for Bioinformatics
...PAUP Phylip Homepage Poy Sinauer Associates TNT-Tree Analysis Using New Technology Tree Base Treefinder Tree-Puzzle Tree View-Taxonomy and S...3940 days ago
Rosalind Problem Solution with Perl
...d programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/probl...3246 days ago
3503 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3246 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G",  ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3246 days ago
Comment on "Interview Puzzles for Bioinformatician !"
Here is the list of puzzles which are asked these days in the Inte...d Triangle Problem Crossing the Bridge Puzzle Burning Rope Timer Puzzle Heaven or Hell Puzzle 10 Coins Puzzle King and Wi...so refer GeeksforGeeks , it has lots of puzzles. Puzzles Archives - Geeksfo...2113 days ago