Generates a genome coverage plot with R
library(CoverageView) ##draw a coverage plot for a test case BAM file #get a BAM test file treatBAMfile2067 days ago
Generate simulated polyploid genome !
#Generate 3% divergence msbar -point 4 -count 16558 toy.fasta > toyheterozygous3percent.fasta #Cat both files cat toy.fasta toymutated3percent.fasta > toyheterozygous3p...sim_reads --depth 50 toyheterozygous3percent.fasta > toyheterozygous3p...2065 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2055 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n";...com =~ s/A/T/g; $revcom =~ s/T/A/g; $revcom =~ s/G/C/g; $revcom =~...rithm, and the reverse complement was wrong!\n"; print "Try again ......2055 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail...-foss-2017b CMake/3.9.1-GCCcore-6.4.0...penMPI/2.0.2-GCC-6.3.0-2.27 freetype/2.8-GCCcore-6.4.0...zlib/1.2.8-goolf-1.4.10 libreadline/6.2-goolf-1.4.10 --...ols distributed via Bioconda are not covered by any service...2046 days ago
2046 days ago
Perl script to create a consensus of nucleotide sequences !
use strict; use warnings; my @instances = qw (...A AACGA ATAAA AGAAA AGAAA); print consensus(@instances),"\n"; # ATAAA print consensus(@instances2),"\n...C=>[], G=>[] ); s/\s//g for @mi; my ($w) = sort {$b $...$_->[$j] }->[$j]++ for @mi_letters; } push @{$H{ u...2044 days ago
2038 days ago
2031 days ago
Installing Platypus on Ubuntu !
(py27) ➜ Tools git:(master) ✗ git clone https://github.com/andyrimmer/Platypus.git...egidx.o sam.o synced_bcf_reader.o vcf_sweep.o tbx.o textutils..._, and __delitem__ instead warning: cython/arrays.pyx:1:0: _...compat -Wl,--sysroot=/ -fno-strict-aliasing -g -O2 -DNDEBUG -...2031 days ago