Results for "Start"
Blogs
XAMPP: Starting Apache fail Ubuntu
...ix the issues please use following command to first stop and then again start it. sudo /etc/init.d/apache2...init.d/mysql stop sudo /etc/init.d/proftpd stop sudo /opt/lampp/lampp start PhpMyAdmin “Wr...3627 days ago
Dynamic chromosome breakpoints !!!
...ng attached microtubules in such a way that half the DNA ends up in each daughter cell. However, before the mitotic spindle‐mediated movement gets start and pulled DNA apart, the chr...3561 days ago
How to Prepare your Bioinformatics CV ?
...e, address and phone number(s) should form the start of the document. If you are g...your academic achievements to date. Content Starting with your current or most...r Interests/Hobbies. If you are a student just starting work, give any evidence yo...3382 days ago
Bioinformatics PhDs - Cover Letter
...ence interview, make reference to it in the cover letter including the names of the faculty with whom you spoke. By the time people actually start to read files, months may hav...3374 days ago
Various scholarships around the world !!
...ch on Climate Change Vulnerability, Impacts and Adaptation (PROVIA) and STARTEligible Students: The fe...ents: Visiting Fellows must have a PhD in mathematics prior to the start of their Fellowship.Courses:&...2826 days ago
String graph based genome assembly software and tools !
...s a PDF report that allows the properties of the genome and data quality to be visually explored. By providing more information to the user at the start of an assembly project, this...2337 days ago
Letter of motivation for bioinformatics applicants !
...ings which you may use directly in your letter. Ideas and main points Start with writing down some of the...e letter (in some cases you can ask for a personal interview) How to start- Your very first line should...2334 days ago
BBTools for bioinformatician !
...ft=25 k=25 literal=AAAAACCCCCTTTTTGGGGGAAAAA In this case, all reads starting with "AAAAACCCCCTTTTTGGGGG...only know the number(s) of the fasta/fastq record(s) in a file (records start at 0) then you can use the fo...2279 days ago
- ...nsufficiently intersects multiple chains Duplicated in new: Sequence sufficiently intersects multiple chains Boundary problem: Missing start or end base in an exon For e...
2169 days ago
Setting python version as default on Linux
...ing above correctly, python2.6 should already be set as the default. If it is not, choose it to be the default. From now on, running python should start version 2.6. Undoing These...2079 days ago
