Results for "Tk"
Bio-Scripts
Bash script to simulate a genome !
...conda activate bcftools1.10.2 # Use Seqtk to convert soft-masked bases...compress with bgzip # https://github.com/lh3/seqtk /genetics/elbers/bin/seqtk/s...pper.diploid.fasta.gz|\ /genetics/elbers/bin/seqtk/seqtk seq -L0|paste - - |grep...929 days ago
Extract fasta sequences with ids in another file !
#Ids are in test.txt - one ids per line #sequences are in test.fa grep -w -A 2 -f test.txt test.fa --no-group-separator # seqtk seqtk subseq test.fa test.txt #faSomeRecods faSomeRecords in.fa listFile out.fa # seqkit seqkit grep -n -f list.txt sequences.fas > newfile2.fas900 days ago
Extract the sequences with IDs !
#sed -i 's/\_/ /g' Delta_seqID_from_lineage_report.txt seqtk subseq genomic.fna Delta_seqID_from_lineage_report.txt > Delta.fasta #Split the fasta in 11 equal sequences subsets pyfasta split -n 11 Delta.fasta862 days ago
- ..."/t" "/n" > OUTFILE.fasta #awk cat infile.fq | awk '{if(NR%4==1) {printf(">%s\n",substr($0,2));} else if(NR%4==2) print;}' > file.fa #seqtk seqtk seq -a input.fastq > output.f...
861 days ago
Extract all fasta sequences except ids !
...!l[$1]}f' genomic.fna > filtered_without_omi.fasta #extract subseq seqtk subseq omi_ids.fa omi_single_...ekmer -f omi_single_id_plus_all.fa -k 19 # Extract the kmer of omi seqtk subseq kmercollection.fasta ....839 days ago
- ...x pkgs/main/noarch::six-1.16.0-pyhd3eb1b0_0 sqlite pkgs/main/linux-64::sqlite-3.37.0-hc218d9a_0 tk pkgs/main/linux-64::tk-8.6.11-h1ccaba5_0 wheel...
836 days ago
bash script to extract sequence by ids !
Use a Perl one-liner, grep and seqtk subseq to extract the desired fasta sequence...equence that correspond to desired gene ids: seqtk subseq in.fasta ids.selected....80075.1.1 GCAAGGGAAAGAAGTATTACTAG Note that seqtk can be installed, for example...834 days ago
- #GATK is a toolkit developed by the broa.... First let’s download and unzip GATK from github. The creators of GATK recommend running GATK throug...create a virtual environment for GATK by using the yaml file includ...ttps://github.com/broadinstitute/gatk/releases/download/4.0.2.1/gat...
822 days ago
- (base) [lege@hn1 testVisanu]$ conda create -n pythonENV python=3.10 scipy=1.13.0 astroid babel Channels: - conda-forge - bioconda - defaults Platform: linux-64 Collecting package metadata (repodata.json): done Solving environment: done ==> WARNING: A newer version of conda exists.
3 days ago
- seqtk seq -F '#' in.fa > out.fq # "#" is fake score.
59 days ago
- « Previous
- 1
- 2
- 3
- 4
- Next »
