Results for "gc"
Pages
Virtual Bioinformatics Online Tutorial
...bioinformatics training centres. Here I provide some of them: Virtual Institute of BioinformaticsNational University of Ireland , Ireland UNIX, GCG, SEQLAB and STADEN Tutorials...3935 days ago
- I found several useful bioinformatics articles which exaplain, define and elaborate the bioinformatics in scientific way. Therefore, instead of writting it again...
3935 days ago
Frequent words problem solution by Perl
...ing.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4;...3267 days ago
Pattern Matching Problem Solution with Perl
...nome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="ATAT";my...3267 days ago
Genome Assembly Tools and Software - PART2 !!
...sp;is a parallel de novo genome assembler for small – mid sized genomes. Contrail 0.8.2 – Assembly of Large Genomes using Cloud ComputingContrail is a Hadoop based...2700 days ago
Awesome perl frameworks, libraries and software - PART 2
licheng/gccfilter - gccfilter is a perl filter to colorize and simplify (or expand) gcc diagnostic messages. gccfilt...1.0 for Perl kberov/PerlProgrammingCourse - A relatively full...e with support for embedded Perl ICGC-TCGA-PanCancer/PCAP-core ...2508 days ago
Awesome perl frameworks, libraries and software - PART 3
...nkakuev/list-cpp-warning-options - A simple Perl script that prints GCC warning options you can appl...miadns - Atomia DNS comotion/VSF - Varnish Security Firewall bgcngm/mtk-tools - Unpack /...2508 days ago
Awesome perl frameworks, libraries and software - PART 4
...e/dnscheck - DNSCheck code, DNS delegation quality checker. darold/pgcluu - PostgreSQL Cluster...kr-StatsD ernstsson/Arqua - Architectural quality analysis tool for GCC project qiaoxueshi/FLEXLoad...2508 days ago
