Bash script to get intergenic region from genome files !
...cat xxx.chrom.sizes | sed 's/^chr//' | sed 's/Cp/Pt/' > tmp mv tmp xxx.chrom.sizes gunzip -c genome_file.gtf.gz | awk 'BEGIN{OFS="\t";} $3=="gene" {print $1,$4-1,$5}' | bedto...1363 days ago
Install and set up i-adhore for synteny and wgd analysis ! -- step by step --
..."1.6.34") -- Configuring done -- Generating done -- Build files ha...object src/CMakeFiles/i-adhore.dir/Gene.cpp.o [ 63%] Building CXX ob...e/anaconda3/envs/wgd/./API/iADHoRe/gene.pm -- Installing: /home/urbe..././testset/datasetI/arath_2_3_beta/genes.txt -- Installing: /home/ur...1201 days ago
bash script to extract sequence by ids !
...BGI_novel_T016817 BGI_novel_G001220 GCCCAAGTCATAGGTAGTGCCTG >BGI_novel_T016141 Solyc03g007600.3.1 ACGTACGTACGTACGTACGTACG EOF cat > gene_ids.txt ids_gene_ids.tsv # Select ids that...821 days ago
297 days ago
92 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
...s to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_fasta = 'path/to/your/genome.fasta'; # Gene ID to extract my $gene_id_to_extract = 'your_gene_id...92 days ago