Results for "repeat content"
Bio-Scripts
Identify genome-wide synteny with LASTZ alignment
#This is the walkstrough how to identifiy genome-wide synteny markers based on LASTZ alignment. Step1：Mask the repeat sequences for both genomes and chromosomes. RepeatM...528 days ago
Perl script to find inverted repeats !
#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; use Bio::Tools::Run::RepeatMasker; my $genome_file = "g...seq = $seqobj->seq(); # run RepeatMasker my $rm = Bio::Tools::R...>run($genome_file); # parse RepeatMasker output while (my $rm_r...} print "Inverted repeat...436 days ago
Raku script to calculate GC content !
sub calculate-gc-content(Str $sequence) { my $gc-count = $sequence....= "ATGCGCTAAAGCGCGCGCCTTACGCGCGCGCGC"; my $gc_content = calculate-gc-content($dna_s...say "DNA Sequence: $dna_sequence"; say "GC Content: $gc_content%";...123 days ago
Raku script to find SSRs in fastq file !
sub find-ssrs(Str $sequence) { my @ssrs; for 2..$sequence.chars -> $min-repeats { for $sequence.chars...$min-repeats -> $max-repeat { my...in-repeats - 1, $max-repeat - $min-repeats + 1); my $repea...end => $max-repeat,...123 days ago
Perl script to calculate GC content !
#!/usr/bin/perl sub calculate_gc_content { my ($sequence) = @_; $sequence = uc($seque...my $total_bases = length($sequence); my $gc_content = ($gc_count / $total_bases) * 100; return $gc_content; } # Example usage: my $...107 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($sequence.chars - $min-repeat-...my $substring = $sequence.substr($i, $min-repeat-length); if $seque...$substring); } } return @repeats...105 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $min-repeat-count = 3) { my @microsatellites; for my $repeat-length ($min-repeat-length..$...my $substring = $sequence.substr($i, $repeat-...105 days ago
Perl script to calculate the basic stats of the assembled genome !
#!/usr/bin/perl use strict; use warnings; use Bio::S...lculate_n50(\@contig_lengths); # Calculate GC content my $gc_content = calculate_gc_content($input...ot reach here } # Subroutine to calculate GC content sub calculate_gc_content {...105 days ago
Python script for basic stats of the assembled genome !
from Bio import SeqIO import statistics # Input file containing the genome...ulative_size >= half_size: return length # Calculate GC content def calculate_gc_content(file): gc_count = 0...105 days ago
- « Previous
- 1
- 2
- Next »
