BOL: Results for "seqtk"

Results for "seqtk"

- Surabhi Chaudhary@surabhi
Extract fasta sequences with ids in another file !
#Ids are in test.txt - one ids per line #sequences are in test.fa grep -w -A 2 -f test.txt test.fa --no-group-separator # seqtk seqtk subseq test.fa test.txt #faSomeRecods faSomeRecords in.fa listFile out.fa # seqkit seqkit grep -n -f list.txt sequences.fas > newfile2.fas
882 days ago
- Abhinav@abhinav
Extract the sequences with IDs !
#sed -i 's/\_/ /g' Delta_seqID_from_lineage_report.txt seqtk subseq genomic.fna Delta_seqID_from_lineage_report.txt > Delta.fasta #Split the fasta in 11 equal sequences subsets pyfasta split -n 11 Delta.fasta
843 days ago
- Rahul Nayak@rahul
Extract all fasta sequences except ids !
...=!l[$1]}f' genomic.fna > filtered_without_omi.fasta #extract subseq seqtk subseq omi_ids.fa omi_single_...uekmer -f omi_single_id_plus_all.fa -k 19 # Extract the kmer of omi seqtk subseq kmercollection.fasta ....
821 days ago
- Abhimanyu Singh@abhimanyu
bash script to extract sequence by ids !
Use a Perl one-liner, grep and seqtk subseq to extract the desired fasta sequences...sequence that correspond to desired gene ids: seqtk subseq in.fasta ids.selected....080075.1.1 GCAAGGGAAAGAAGTATTACTAG Note that seqtk can be installed, for example...
816 days ago
- LEGE@lege
Fasta to Fastq conversion !
seqtk seq -F '#' in.fa > out.fq # "#" is fake score.
41 days ago