Download lumpy skin disease data !
Location https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=880745 The raw genome sequence data from the 2022 outbreak in India is available in the SRA Project PRJNA880745430 days ago
Python script to convert Multi-line Fasta to Single-line Fasta
def multi_to_single_line_fasta(input_filename, output_filename): try: with open(input_filename, 'r') as input_file: with open(output_filename...115 days ago
Perl script to convert Multi-line Fasta to Single-line Fasta !
#!/usr/bin/perl use strict; use warnings; sub multi_to_single_line_fasta { my ($input_filename, $output_filename) = @_; open my $input_file, '', $out...115 days ago
Bash script to convert Multi-line Fasta to Single-line Fasta !
#!/bin/bash input_filename="multi_line.fasta" output_filename="single_line.fasta" awk '/^>/ {printf("\n%s\n", $0);next; } { printf("%s", $0);} END {printf("\n");...115 days ago
114 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_...114 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($s...return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-...114 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $mi...microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-...114 days ago
Perl script to calculate the basic stats of the assembled genome !
#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; # Input file containing the genome assembly in FASTA format my $input_file = 'genome_assembly.fasta'; # Create Bio::SeqIO object to...nt the computed statistics and information print "Genome...114 days ago
Python script for basic stats of the assembled genome !
from Bio import SeqIO import statistics # Input file containing the genome assembly in FASTA format input_file = 'genome_assembly.fasta' # Variables for computing statistics...# Print the computed statistics and information print("Genome...114 days ago