Python script to download covid genome !
...s://www.ncbi.nlm.nih.gov/core/assets/genbank/files/ncov-sequences.yaml").text) seqs = seqs['genbank-sequen...dna = Entrez.efetch(db='nucleotide',id=nm, rettype = 'fasta', retmode= 'text').read().split("\n")[1:]...1153 days ago
Retrieve NCBI GenBank records with a range of accession numbers
.... ( $retstart + $retmax ) . "\n" ); my $efetch = "$param{url}/efetch.fcgi?rettype=$param{returnType}&retmode=text&retstart=$retstart&retmax=$re...2932 days ago
2927 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
...in/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $& if(exists $resu...2926 days ago
Perl script to extract fasta sequence by matching name/ids !!
#!/usr/bin/perl use strict; use warnings; use Text::Trim qw(trim); #Usage perl extractSeqbyID.pl ids.txt seq.fasta Result.fasta $ARGV[2] or die "use extractSeqbyID.pl LIST...2891 days ago
Install ATOM editor on Elemantory OS / Ubuntu
...t this usage message Prefix an option with `no-` to set it to false such as --no-color to disable colored output. #Atom is essentially a text editor that you can use for c...1192 days ago
Read a tab delimited file and search with perl
use strict; use warnings; use Data::Dumper; use Text::CSV; use IO::Handle; my $file = "/home/urbe/Tools/Alienomics_v0.1/Alienomics/output/intermediate_files/rRNA/refGene.megablast"; open my $fh, "[0]\n"; warn Dumper $row; # To see the structure }2542 days ago
Extract fasta sequence with Ids with Bash script
#!/bin/bash while IFS='' read -r line || [[ -n "$line" ]]; do echo "Text read from file: $line" samtools faidx ONT.fasta $line > $line.faa done < "$1"2371 days ago
Plot the density of genes in R
...lot2" %in% rownames(installed.packages())){ library(ggplot2) } else { install.packages("ggplot2") library(ggplot2) } # import a text file with gene positions # c...2301 days ago
Installing Busco version 4.0.6
...h553295d_18 22 KB conda-forge gettext-0.19.8.1 | hc5be...pl526_3 126 KB bioconda perl-text-abbrev-1.02 | p.../linux-64::gcc_linux-64-7.3.0-h553295d_18 gettext conda-forge/linux-...1469 days ago