Python script to download covid genome !
#!/usr/bin/env python3 # these are the publicly available "complete" sequences # h...gov/core/assets/genbank/files/ncov-sequences.yaml").text) seqs = seqs['genbank-sequen...db='nucleotide',id=nm, rettype = 'fasta', retmode= 'text')...1148 days ago
Retrieve NCBI GenBank records with a range of accession numbers
#!/usr/bin/perl #FILE: ncbi_search.pl #AUTH: Paul Stothard (paul.stothard@gmail.com) use warnings; use str...etch = "$param{url}/efetch.fcgi?rettype=$param{returnType}&retmode=text&r...2928 days ago
2922 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text =...2921 days ago
Perl script to extract fasta sequence by matching name/ids !!
#!/usr/bin/perl use strict; use warnings; use Text::Trim qw(trim); #Usage perl extractSeqbyID.pl ids.txt seq.fasta Result.fasta $ARGV[2] or die "use extractSeqbyID.pl...2887 days ago
Install ATOM editor on Elemantory OS / Ubuntu
#Download ATOM deb file from https://atom.io/ https://atom.io/download/deb (base) bioqueen@bioqueen-Lenovo-ide...alse such as --no-color to disable colored output. #Atom is essentially a text e...1188 days ago
Read a tab delimited file and search with perl
use strict; use warnings; use Data::Dumper; use Text::CSV; use IO::Handle; my $file = "/home/urbe/Tools/Alienomics_v0.1/Alienomics/output/intermediate_files/rRNA/refGene.megablast"; open my $fh, "[0]\n"; warn Dumper $row; # To see the structure }2537 days ago
Extract fasta sequence with Ids with Bash script
#!/bin/bash while IFS='' read -r line || [[ -n "$line" ]]; do echo "Text read from file: $line" samtools faidx ONT.fasta $line > $line.faa done < "$1"2367 days ago
Plot the density of genes in R
#column1 = chromosome name and column2 = start position of the gene # check if ggplot2 is installed, if so, loa...else { install.packages("ggplot2") library(ggplot2) } # import a text f...2296 days ago
Installing Busco version 4.0.6
(base) jit@jit-HP-Pro-3335-MT: conda install -c bioconda -c conda-forge b...18 22 KB conda-forge gettext-0.19.8.1 | hc5be...6_3 126 KB bioconda perl-text-abbrev-1.02 | p...::gcc_linux-64-7.3.0-h553295d_18 gettext...1465 days ago