String graph based genome assembly software and tools !
...ing". String graphs were first proposed by E. W. Myers in a 2005 publication. In rec...NGS reads. It is relatively easy to extend BASE to include scaffolding. 5. Fermi https://gith...2347 days ago
Letter of motivation for bioinformatics applicants !
A motivation letter, or sometimes called letter of motivation or motivational letter, is actually a letter being send together with your professional resume to suppo...2343 days ago
Installing Perl environment on Linux
..."' >> ~/.bashrc $ source ~/.bashrc $ plenv install 5.18.1 -Dusethreads $ plenv rehash $ plenv global 5.18.1 $ plenv install-cpanm...Put the following path into ~/.bashrc file. export PERL5LIB="$HOME/.plenv/build/perl-5...2340 days ago
List of cancer genomics research web resources !
...Interface for cancer program resources GDAC http://gdac.broadinstitute.org/ Data analysis; automatic pipelines; user-friendly reports SNP500Cancer http://snp500cancer.nci.nih.gov Sequence...2339 days ago
Bioinformatics tools developed for Oxford Nanopore data analysis !
...and variant-calling softwarehttps://github.com/tszalay/poreseq PoretoolsNanopore sequence analysis and visualization software https://github.com/arq5x/poretools SSPACE-LongReadGe...2339 days ago
BBTools for bioinformatician !
...AC 100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are...in=x.sam out=y.sam minlength=50 maxlength=200 Filter SA...hen mapping.Bear in mind that 50% of the reads are going to b...gth=100 out=synth.fastq maxq=35 midq=25 minq=15 [*]Map to...2289 days ago
Basic command-line to run BLAST
...human.1.protein.faa \ -out cow_vs_human_blast_results.tab \ -evalue 1e-5 \ -outfmt 7 I broke t...human.1.protein.faa \ -out cow_vs_human_blast_results.tab \ -evalue 1e-5 \ -outfmt 6 \ -max_target_s...2262 days ago
Popular bioinformatics educational resources !
...rates the use of bioinformatics in their study. Bioinfo.mbb.yale.edu/mbb452a/2003/ Bioinformatics cours...mical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulate...2211 days ago
Installing Bandage on Ubunty !
...all build-essential git qtbase5-dev libqt5svg5-dev Download the Bandage...64 libxkbcommon-x11-0 amd64 0.5.0-1ubuntu2 [13,5 kB]Get:11 ht...pack .../libxkbcommon-x11-0_0.5.0-1ubuntu2_amd64.deb ...Unpac...L/home/urbe/anaconda3/lib -lQt5Svg -lQt5Widgets -lQt5Gui -lQt...2207 days ago
Install ImageMagick from Unix Source
...77/77), done.remote: Total 124593 (delta 94), reused 94 (delt...for x86 cpuid 0 output... d:756e6547:6c65746e:49656e69checki...gsfonts/checking for URW-base35 fonts directory... not found!...MagickWand/dir_101f7ac0a894e32543a314e85b2e1524.html /usr/loc...2164 days ago