String graph based genome assembly software and tools !
...g are the genome assembly tools based on string graph: 1.SGA (String Graph Assembler) https://github.com/jts/sga Assembles large genomes from...that fast string graph (FSG) is significantly faster than SGA while maintaining a moderate...2379 days ago
Letter of motivation for bioinformatics applicants !
...eriences (international experiences are always relevant) and qualities; organise the middle paragraphs in...….. or I am writing here to apply for the… or This is regarding your advert. published&h...2376 days ago
List of cancer genomics research web resources !
Major web resources for cancer genomics research CGHub https://cghub.ucsc.edu/ Comprehensive data repository; huge data size EGA https://www.ebi.ac.uk/ega/ Comprehensive data repository; huge...2371 days ago
Bioinformatics tools developed for Oxford Nanopore data analysis !
...tware for nanopore data, quality and error profileshttps://documentation.tgac.ac.uk/display/NANOOK/NanoOK...Nanocorrect, Nanopolish correctorhttps://github.com/jts/nanopolish PBcRHGAP or BLASR, Celera OLC PBcR co...2371 days ago
BBTools for bioinformatician !
...icing, which depends on the organism.-------------------------...25 literal=AAAAACCCCCTTTTTGGGGGAAAAA In this case, all read...quences so if they are many megabases long you may need to add...00-A74HF:1:2110:14788:23085 ATGA=8 ATGC=6 GTCA=6 AAAT=5 AAGC=5...2321 days ago
Basic command-line to run BLAST
...BLAST Now we can blast these two cow sequences against the set of human sequence...rs] [-gilist filename] [-seqidlist filename] [-negative_gilist filename] [-negati...^>' cow.medium.faa Lets run the blast again, but this time lets return...2295 days ago
Check product if already exist in to cart using woocommerce.
.... __( 'This product is already in your cart.', 'woocommerce' ), 'error' );// Stop the function returning "false", so the products will not be added againreturn $passed;}}return $pas...2248 days ago
Popular bioinformatics educational resources !
...informatics at the University of Skovde, Sweden. Members.tripod.com/C.elegans/ Resources in biochemical, molecular, cellular, system, and organism biology, including over 2...2243 days ago
Install ImageMagick from Unix Source
...... /bin/mkdir -pchecking for gawk... gawkchecking whether mak...(cached) /bin/sedchecking for gawk... (cached) gawkchecking if...emptyset... yeschecking for sigaction... yeschecking for spawn...g.status: creating config/delegates.xmlconfig.status: creating...2197 days ago
chromoMap-An R package for Interactive visualization and mapping of human chromosomes
chromoMap is an R package that provides interactive, configurable and elegant graphics visualization of th...map thousands of genes and can view all mappings easily. Users can investigate the detailed information ab...2191 days ago