BBTools for bioinformatician !
...sking of low-complexity repetitive kmers, which is not usually a prob...ition 19, zero-based). Code: $ kmercountexact.sh in=trimmed.fq ou...p; Extract sequences that share kmers with your sequences with BBD...for sequence data Code: $ kmercountexact.sh in=reads.fq khis...2298 days ago
Useful Bioinformatics Analysis Tools !
...ting on a PC, BMC Bioinformatics, 2013; 14():Article no. 160, Kmer-db Tool for estimation of ev...; Deorowicz, S., Gudys, A., Dlugosz, M., Kokot, M., Danek, A., Kmer-db: instant evolutionary dist...890 days ago
2969 days ago
2741 days ago
Frequent words problem solution by Perl
...my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0;for (...bsp; my $myStr=substr $string, $aa,$kmer; #print "$m...; print "$name " if $myHash{$name} == $max;}sub kmerMatch { #Check the exact match...3279 days ago
Pattern Matching Problem Solution with Perl
...where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="ATAT";my $kmer=length($subStr);kmerMatch ($string, $subStr, $kmer...3279 days ago
Commercial and public next-gen-seq (NGS) software
...homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence nu...3546 days ago
Software packages for next gen sequence analysis
...homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence nu...3269 days ago
Clump Finding Problem Solved with Perl
...TGCGACATAATGTACGAATGTAATGTGCCTATGGC"; my $subStr="?"; my $clump=4; my $kmer=5; for (my $aa=0; $aa $max...e (keys %myHash){ print "$name " if $myHash{$name} == $clump; } kmerMatch ($string, $subStr, $kmer...2361 days ago
2154 days ago
Comment on "KAT: a K-mer analysis toolkit to quality control NGS datasets and genome assemblies"
...;gnuplot/4.6.5) – we can plot the kmer content of the assembly compared to the kmer content of the read set. The...now use kat comp to create a kmer content comparison. Use ...png file that was produced. Does the kmer content look good to you? Ho...1364 days ago
Comment on "Estimate Genome Size"
...find_valleys.pl to help pinpoint the actual peak find_valleys.pl fastq.counts_0.histo # estimate the size and coverage estimate_genome_size.pl --kmer=31 --peak=42 --fastq=reads1.f...1925 days ago