Results for "N characters"
Blogs
...cestral indel states assuming a continuous time Markov process. FastML provides the most likely ancestral sequences, integrating both indels and characters; (ii) FastML accounts for unc...2575 days ago
List of perl special symbols !
There are some variables which have a predefined and special meaning in Perl. They are the variables that use punctuation characters after the usual variable indicator ($, @, or %), suc...1604 days ago
- +3 more Blogs
Bookmarks
- ...or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Adapter sequences can contain IUPAC wildcard characters. Also, paired-end reads and e...
2959 days ago
- ...or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Adapter sequences can contain IUPAC wildcard characters. Also, paired-end reads and e...
2744 days ago
- +4 more Bookmarks
Files
- Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.
3911 days ago
Pages
Awesome perl frameworks, libraries and software - PART 2
...erstripe-unidecode - Unidecode is a PHP version of the perl module Text::Unicode. It takes UTF-8 data and tries to represent it in US-ASCII characters. aleimba/bac-genomics-script...2539 days ago
Awesome perl frameworks, libraries and software - PART 3
...erstripe-unidecode - Unidecode is a PHP version of the perl module Text::Unicode. It takes UTF-8 data and tries to represent it in US-ASCII characters. exhuma/jsttyplay - A s...2539 days ago
Top-level pages
Perl one-liner for bioinformatician !!!
...p {$_ % 2 == 0} 1..100; print "@even"'#Generate an array of even numbersperl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file #Convert the entire file into 13 characters offset(ROT13)perl -nle 'print...3673 days ago
- ...ional flag "-Xmx2g". For example, to change the line-wrapping length on the human genome (which has individual sequences over 200Mbp long) to 70 characters: reformat.sh -Xmx2g in=HG19.f...
2759 days ago
- +8 more Top-level pages
Wire posts
Opportunity posts
2 positions on the evolutionary analysis of biological sequences in Montpellier - France
...liation, comparative genomics, phylogenetic network inference and verification, phylogeography, the use of phylogenies to study the evolution of characters. A one thousand year old...3187 days ago
Bio-Scripts
Find and replace ambiguous characters in fasta file with Perl and Bioperl
...-m: missing character\n". "Print out the name of sequences with characters other than ATGC-.\n". "If -m is specified, the ambiguous characters are repleced with the\n"....2959 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2954 days ago
- +2 more Bio-Scripts
