Results for "miRNA target gene"
Top-level pages
LINKS scaffolder bloomfilter setting !
➜ bin git:(master) ✗ ls -l total 68 drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib -rwxrwxrwx 1 urbe urbe 65141 J...ACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC -d distance between k-mer pairs (ie. targ...2179 days ago
Understanding BLASTn output format 6 !
BLASTn output format 6 BLASTn maps DNA against DNA, for example gene sequences against a reference genomeblastn -query genes.ffn -subject genome.fna -o...itscore 1. qseqid query (e.g., gene) sequence id 2. sseqi...2166 days ago
Interview Puzzles for Bioinformatician !
These are some of the most famous Interview Puzzles being asked in top tech companies.Here is a list of Top 25 puzzles which have been asked in top Tech Interview....2147 days ago
- Short Read Simulators With the popularity of next-generation sequencing (NGS) technologies, many N.... MetaSim wgsim SimNGS ArtificialFastqGenerator InSilicoSeq Long Rea...shown an increasing interest in using third-generation sequencing (TGS) techno...
611 days ago
Tools for Geospatial data analysis !
Geospatial data is becoming increasingly important in many fields, including urban planning, environmental science, public health, and more. These...438 days ago
Steps to find all the repeats in the genome !
To find repeats in a genome from 2 to 9 length using a P...nd 9). Analyze the output: RepeatMasker will generate several output files, inc...hs of the reference elements. This script will generate several output files, inc...276 days ago
Mitochondrial genome assembly tools !
Mitochondrial genome assembly tools are spe...obtained through techniques like next-generation sequencing (NGS). The mit...he nuclear genome, making it an ideal target for assembly. Here are some...al genomes and annotate mitochondrial genes from trimmed read sequencing...270 days ago
