Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
Bioinformatics jobs in Spain http://genome.crg.es/main/joboffers.php2142 days ago
Comment on "HALC: High throughput algorithm for long read error correction"
...Inputs Long reads in FASTA format. Contigs assembled from the corresponding short reads in FA...(only for -ordinary mode; obtained with cat left_reads.fa >short_rea...Using AlignGraph runHALC.py long_reads.fa contigs.fa [-options|-options]...2153 days ago
2160 days ago
Comment on "Nanopolis: polish a genome assembly"
# Index the draft genome bwa index draft.fa # Align the basecalled reads to the draft sequence bwa mem -x ont2d -t 8 draft.f...el --results nanopolish.results -P 8 \ nanopolish variants --consensus -o polished.{1}.vcf -...2161 days ago
Comment on "Installing Porechop on Ubuntu !"
➜ MyPassport porechop -i /media/urbe/MyDDrive/ON...76.7 1D^2 part 2 91.2 80.6 Barcode 1 (reverse) 76.0 78.6 Barc...code 5 (forward) 75.0 75.0 Barcode 6 (forward) 76.9 76.9 Barc...ode 37 (forward) 80.0 80.0 Barcode 38 (forward) 76.0 80.8 Bar...t: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT 1D2_part_2_end: CACCCAAG...2167 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
Bioinformatics jobs at https://www.monster.com/jobs/search/?q=Bioinformatics&intcid=skr_navigation_nhpso_searchMain&jobid=1985086042167 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
EUROPE EURAXESS https://euraxess.ec.europa.eu/site/search?keywords=bioinformatics2174 days ago
Comment on "Interview Puzzles for Bioinformatician !"
Here is the list of puzzles which are asked these days in the Interview Ant and Triangle Problem Crossing the Bridge Puzzle Bur...er Puzzle Heaven or Hell Puzzle 10 Coins Puzzle King and Wine Bot..., it has lots of puzzles. Puzzles Archives - GeeksforGeeks2181 days ago
Comment on "Various scholarships around the world !!"
Young Scientist Fellowship, Korea 1. Purpose and Background With the vision of "Making Discoveries for Humanity and Socie...," the Institute for Basic Science (IBS) was founded in...aborations with leading researchers.We hope that the YS...2181 days ago
Comment on "Ancestral sequence reconstruction steps !"
Parallelization of MAFFT for large-scale multiple sequence alignmentshttps://academic.oup.com/bioinformatics/article/34/14/2490/49160992182 days ago