2747 days ago
BASH script for SelfBLAST a genome
...o blast" SEQ=$FASTAFILE else echo "Something went wrong $USER - Contact jitendra" fi echo "Doing alignments -- BLASting"; blastn -task megablast -query $SEQ -db $MYDB -e...2706 days ago
Read a tab delimited file and search with perl
use strict; use warnings; use Data::Dumper; use Text::CSV; use IO::Handle; my $file = "/home/urbe/Tools/Alienomics_v0.1/Alienomics/output/intermediate_files/rRNA/refGene.megablast"; open my $fh, "[0]\n"; warn Dumper $row; # To see the structure }2579 days ago
2524 days ago
Genetic Algorithms demonstration with word DNA in Perl
#!/usr/bin/perl -w # GA demonstration with word DNA (512 bits) use strict; use Data::Dumper; # i...on to sample from an array of weighted elements # originally written by Abigail # Documentation for the a...2426 days ago
Clump Finding Problem Solved with Perl
...integers k, L, and t. #Return: All distinct k-mers forming (L, t)-clumps in Genome. use strict; use warnings; my %myHash; my $string="CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGA...2388 days ago
Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast...2380 days ago
Create genome scaffolding with Perl
#!/usr/bin/perl use warnings; use strict; use English; use Pod::Usage; ## uses pod documentation in usage code use Getopt::Long qw(:config auto_version auto_...2363 days ago
Remove duplicate lines with perl
#! perl -sw use strict; my %lines; #open DATA, $ARGV[0] or die "Couldn't open $ARGV[0]: $!\n"; while () { print if not $lines{$_}++; } __DATA__ apple apple plum vinegar apple banana banana banana apple2347 days ago
Remove the duplicated line present only next to each other with Perl
...line$/"; print $_ if $_ ne $next_line; } continue { $_ = $next_line; } print $_ if eof; } __DATA__ apple apple plum vinegar apple banana banana bana...2347 days ago